Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632984_s_at:

>probe:Drosophila_2:1632984_s_at:482:341; Interrogation_Position=124; Antisense; GCTTTTGAAATGCACTTGGCTATTG
>probe:Drosophila_2:1632984_s_at:5:279; Interrogation_Position=143; Antisense; CTATTGGTTTTGCTGCTGTCCGTAA
>probe:Drosophila_2:1632984_s_at:249:621; Interrogation_Position=156; Antisense; TGCTGTCCGTAATGGCAGGTGCCTT
>probe:Drosophila_2:1632984_s_at:696:65; Interrogation_Position=167; Antisense; ATGGCAGGTGCCTTTGCCAGCAGCG
>probe:Drosophila_2:1632984_s_at:717:91; Interrogation_Position=18; Antisense; AGTTGCATTTTCTAGTTGCCCAAGG
>probe:Drosophila_2:1632984_s_at:644:441; Interrogation_Position=192; Antisense; GATGTCCTGCGGGATATAGTGCCGA
>probe:Drosophila_2:1632984_s_at:74:385; Interrogation_Position=217; Antisense; GAACAATCGGTGCACCATTGAGCGT
>probe:Drosophila_2:1632984_s_at:245:129; Interrogation_Position=230; Antisense; ACCATTGAGCGTCCTGTTCACGGCT
>probe:Drosophila_2:1632984_s_at:524:665; Interrogation_Position=275; Antisense; TACAGCCTGAACATCAACAAGTGCG
>probe:Drosophila_2:1632984_s_at:673:183; Interrogation_Position=290; Antisense; AACAAGTGCGTCCACTCCTAAGGAT
>probe:Drosophila_2:1632984_s_at:509:259; Interrogation_Position=302; Antisense; CACTCCTAAGGATCTCGTCGAATAA
>probe:Drosophila_2:1632984_s_at:207:623; Interrogation_Position=34; Antisense; TGCCCAAGGTGAGTTGAGGCTGCCT
>probe:Drosophila_2:1632984_s_at:493:439; Interrogation_Position=49; Antisense; GAGGCTGCCTAGTATTCCAATTCAA
>probe:Drosophila_2:1632984_s_at:491:191; Interrogation_Position=73; Antisense; AACTACGGATTTTCTTTCAAGTGCA

Paste this into a BLAST search page for me
GCTTTTGAAATGCACTTGGCTATTGCTATTGGTTTTGCTGCTGTCCGTAATGCTGTCCGTAATGGCAGGTGCCTTATGGCAGGTGCCTTTGCCAGCAGCGAGTTGCATTTTCTAGTTGCCCAAGGGATGTCCTGCGGGATATAGTGCCGAGAACAATCGGTGCACCATTGAGCGTACCATTGAGCGTCCTGTTCACGGCTTACAGCCTGAACATCAACAAGTGCGAACAAGTGCGTCCACTCCTAAGGATCACTCCTAAGGATCTCGTCGAATAATGCCCAAGGTGAGTTGAGGCTGCCTGAGGCTGCCTAGTATTCCAATTCAAAACTACGGATTTTCTTTCAAGTGCA

Full Affymetrix probeset data:

Annotations for 1632984_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime