FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632988_at:

>probe:Drosophila_2:1632988_at:406:581; Interrogation_Position=113; Antisense; TGGCCTGTATATCGAACACCTCATT
>probe:Drosophila_2:1632988_at:126:53; Interrogation_Position=13; Antisense; ATGCTGCGCTGCTTGATCTTGCTGG
>probe:Drosophila_2:1632988_at:463:515; Interrogation_Position=183; Antisense; GTGTCCCACGGGTTATTATTGCACC
>probe:Drosophila_2:1632988_at:679:103; Interrogation_Position=231; Antisense; AGACGTGGCCCAAAGATCCTGTATA
>probe:Drosophila_2:1632988_at:511:467; Interrogation_Position=257; Antisense; GTTGTGGCACCTGCGATAGTGGCAA
>probe:Drosophila_2:1632988_at:119:647; Interrogation_Position=29; Antisense; TCTTGCTGGCAATCGGAGTTTTCCT
>probe:Drosophila_2:1632988_at:542:73; Interrogation_Position=304; Antisense; AGGACATTTGCCCTGTGCCTGGGAA
>probe:Drosophila_2:1632988_at:730:77; Interrogation_Position=417; Antisense; AGGATCACAGGCCACTTGTCCGGGT
>probe:Drosophila_2:1632988_at:122:425; Interrogation_Position=44; Antisense; GAGTTTTCCTGGTGATCCGTATTCT
>probe:Drosophila_2:1632988_at:211:587; Interrogation_Position=461; Antisense; TGGATGTTACGTCAACGACACCCAC
>probe:Drosophila_2:1632988_at:249:563; Interrogation_Position=514; Antisense; GGAAGATTTCCCTACGGCATTGATC
>probe:Drosophila_2:1632988_at:526:5; Interrogation_Position=532; Antisense; ATTGATCTCAACACAACCTGCAGAC
>probe:Drosophila_2:1632988_at:199:465; Interrogation_Position=82; Antisense; GATTGCAATGTGTGTGCCTCCGTTA
>probe:Drosophila_2:1632988_at:269:307; Interrogation_Position=98; Antisense; CCTCCGTTAGCAATGTGGCCTGTAT

Paste this into a BLAST search page for me
TGGCCTGTATATCGAACACCTCATTATGCTGCGCTGCTTGATCTTGCTGGGTGTCCCACGGGTTATTATTGCACCAGACGTGGCCCAAAGATCCTGTATAGTTGTGGCACCTGCGATAGTGGCAATCTTGCTGGCAATCGGAGTTTTCCTAGGACATTTGCCCTGTGCCTGGGAAAGGATCACAGGCCACTTGTCCGGGTGAGTTTTCCTGGTGATCCGTATTCTTGGATGTTACGTCAACGACACCCACGGAAGATTTCCCTACGGCATTGATCATTGATCTCAACACAACCTGCAGACGATTGCAATGTGTGTGCCTCCGTTACCTCCGTTAGCAATGTGGCCTGTAT

Full Affymetrix probeset data:

Annotations for 1632988_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720