FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632991_at:

>probe:Drosophila_2:1632991_at:232:523; Interrogation_Position=1026; Antisense; GGGCCTTGCAAGTCGACACAATATG
>probe:Drosophila_2:1632991_at:402:705; Interrogation_Position=539; Antisense; TTCAAAACGGCCATCAGCATGCAGC
>probe:Drosophila_2:1632991_at:475:225; Interrogation_Position=569; Antisense; AATAGCCGGGTTATTCGGAATCTCT
>probe:Drosophila_2:1632991_at:221:563; Interrogation_Position=585; Antisense; GGAATCTCTCCTATTTTCAGGCCAA
>probe:Drosophila_2:1632991_at:640:635; Interrogation_Position=601; Antisense; TCAGGCCAACTACGTTTTCATCTTT
>probe:Drosophila_2:1632991_at:102:59; Interrogation_Position=635; Antisense; ATGATATACTGCCTCATCACGGCTC
>probe:Drosophila_2:1632991_at:156:703; Interrogation_Position=691; Antisense; TTTTGGCTGCCATAAGCTGCGCGTG
>probe:Drosophila_2:1632991_at:286:625; Interrogation_Position=708; Antisense; TGCGCGTGCGCAACAGTAACATTAC
>probe:Drosophila_2:1632991_at:193:687; Interrogation_Position=729; Antisense; TTACCATCGTGGGACAACAACTGAC
>probe:Drosophila_2:1632991_at:450:97; Interrogation_Position=765; Antisense; AGATCATCGCACTCAATCTGGCGAC
>probe:Drosophila_2:1632991_at:258:535; Interrogation_Position=842; Antisense; GGTGCTTCATGCTTCGTGATTGCTA
>probe:Drosophila_2:1632991_at:622:551; Interrogation_Position=907; Antisense; GGAGAATGAGGGTTTCCTCGCCCAG
>probe:Drosophila_2:1632991_at:697:123; Interrogation_Position=946; Antisense; AGCCAGAAGCTAAACCCTAGGTCTT
>probe:Drosophila_2:1632991_at:119:307; Interrogation_Position=961; Antisense; CCTAGGTCTTCTGGGATCGTGGCAA

Paste this into a BLAST search page for me
GGGCCTTGCAAGTCGACACAATATGTTCAAAACGGCCATCAGCATGCAGCAATAGCCGGGTTATTCGGAATCTCTGGAATCTCTCCTATTTTCAGGCCAATCAGGCCAACTACGTTTTCATCTTTATGATATACTGCCTCATCACGGCTCTTTTGGCTGCCATAAGCTGCGCGTGTGCGCGTGCGCAACAGTAACATTACTTACCATCGTGGGACAACAACTGACAGATCATCGCACTCAATCTGGCGACGGTGCTTCATGCTTCGTGATTGCTAGGAGAATGAGGGTTTCCTCGCCCAGAGCCAGAAGCTAAACCCTAGGTCTTCCTAGGTCTTCTGGGATCGTGGCAA

Full Affymetrix probeset data:

Annotations for 1632991_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720