FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632992_at:

>probe:Drosophila_2:1632992_at:206:97; Interrogation_Position=1028; Antisense; AGATGCCTACCGGAAACAGCTGTTC
>probe:Drosophila_2:1632992_at:126:109; Interrogation_Position=1064; Antisense; AGAACCATCGTCTTTAGCCCAGGGA
>probe:Drosophila_2:1632992_at:326:699; Interrogation_Position=1076; Antisense; TTTAGCCCAGGGACATAACCAGCAA
>probe:Drosophila_2:1632992_at:343:445; Interrogation_Position=1111; Antisense; GATCCGCAGCCTATGGTGGTTCCCA
>probe:Drosophila_2:1632992_at:532:257; Interrogation_Position=1157; Antisense; CACATCCGATTTCCTGCAAATGCAG
>probe:Drosophila_2:1632992_at:458:167; Interrogation_Position=1174; Antisense; AAATGCAGTCCCACTCGTATCAGCT
>probe:Drosophila_2:1632992_at:39:3; Interrogation_Position=1192; Antisense; ATCAGCTGCCTTCAACGTTTACTAC
>probe:Drosophila_2:1632992_at:385:21; Interrogation_Position=1208; Antisense; GTTTACTACTCACACGGAATGGACC
>probe:Drosophila_2:1632992_at:670:565; Interrogation_Position=1278; Antisense; GGCAATCGTCAGTACTCGGCTAGTG
>probe:Drosophila_2:1632992_at:240:669; Interrogation_Position=1401; Antisense; TACTAAGGCCCTTGAACAGACTTAA
>probe:Drosophila_2:1632992_at:538:195; Interrogation_Position=1436; Antisense; AACTGGTAGTTCGATGCTCCACATC
>probe:Drosophila_2:1632992_at:412:487; Interrogation_Position=1473; Antisense; GTACCAACTTCAACATTCGCTTTTC
>probe:Drosophila_2:1632992_at:461:695; Interrogation_Position=1494; Antisense; TTTCCCCGGAAAAGCATTTGGTCTG
>probe:Drosophila_2:1632992_at:67:515; Interrogation_Position=1544; Antisense; GTGTGCAGATAAATACTTTTCCCTT

Paste this into a BLAST search page for me
AGATGCCTACCGGAAACAGCTGTTCAGAACCATCGTCTTTAGCCCAGGGATTTAGCCCAGGGACATAACCAGCAAGATCCGCAGCCTATGGTGGTTCCCACACATCCGATTTCCTGCAAATGCAGAAATGCAGTCCCACTCGTATCAGCTATCAGCTGCCTTCAACGTTTACTACGTTTACTACTCACACGGAATGGACCGGCAATCGTCAGTACTCGGCTAGTGTACTAAGGCCCTTGAACAGACTTAAAACTGGTAGTTCGATGCTCCACATCGTACCAACTTCAACATTCGCTTTTCTTTCCCCGGAAAAGCATTTGGTCTGGTGTGCAGATAAATACTTTTCCCTT

Full Affymetrix probeset data:

Annotations for 1632992_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720