Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632993_at:

>probe:Drosophila_2:1632993_at:505:633; Interrogation_Position=1596; Antisense; TCCCGTTGTGGAACTTCTACAGCAA
>probe:Drosophila_2:1632993_at:25:449; Interrogation_Position=1742; Antisense; GATGCCACCAATGTGATGGTCACCA
>probe:Drosophila_2:1632993_at:664:535; Interrogation_Position=1759; Antisense; GGTCACCAACGGTATTGACTTCGAG
>probe:Drosophila_2:1632993_at:217:403; Interrogation_Position=1775; Antisense; GACTTCGAGTACCTGCGACGCGGAA
>probe:Drosophila_2:1632993_at:105:411; Interrogation_Position=1809; Antisense; GACCCACTCGTACTCTTATCGAATT
>probe:Drosophila_2:1632993_at:420:155; Interrogation_Position=1840; Antisense; ACAGACGATCTGCAAAGACACCGCT
>probe:Drosophila_2:1632993_at:450:157; Interrogation_Position=1857; Antisense; ACACCGCTCCCAAGATGGGCAAGTA
>probe:Drosophila_2:1632993_at:191:427; Interrogation_Position=1894; Antisense; GAGATCGGGCCATGAGCAGCTGACC
>probe:Drosophila_2:1632993_at:85:335; Interrogation_Position=1912; Antisense; GCTGACCGAAGATGCGAAATCCCAA
>probe:Drosophila_2:1632993_at:576:235; Interrogation_Position=1929; Antisense; AATCCCAACGGCAGTGACAGCGCTA
>probe:Drosophila_2:1632993_at:205:263; Interrogation_Position=1946; Antisense; CAGCGCTATCACTATGTCCATATTT
>probe:Drosophila_2:1632993_at:264:89; Interrogation_Position=1987; Antisense; AGTCTGTGCAGGATGGATGTCTTTA
>probe:Drosophila_2:1632993_at:713:429; Interrogation_Position=2002; Antisense; GATGTCTTTAGTCAGTTCGTCAGCG
>probe:Drosophila_2:1632993_at:315:243; Interrogation_Position=2036; Antisense; AATTTCCAACGACATTGTTCCCAGG

Paste this into a BLAST search page for me
TCCCGTTGTGGAACTTCTACAGCAAGATGCCACCAATGTGATGGTCACCAGGTCACCAACGGTATTGACTTCGAGGACTTCGAGTACCTGCGACGCGGAAGACCCACTCGTACTCTTATCGAATTACAGACGATCTGCAAAGACACCGCTACACCGCTCCCAAGATGGGCAAGTAGAGATCGGGCCATGAGCAGCTGACCGCTGACCGAAGATGCGAAATCCCAAAATCCCAACGGCAGTGACAGCGCTACAGCGCTATCACTATGTCCATATTTAGTCTGTGCAGGATGGATGTCTTTAGATGTCTTTAGTCAGTTCGTCAGCGAATTTCCAACGACATTGTTCCCAGG

Full Affymetrix probeset data:

Annotations for 1632993_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime