FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632998_at:

>probe:Drosophila_2:1632998_at:238:531; Interrogation_Position=2658; Antisense; GGGTGTGGACAAACCTCATCCGCTT
>probe:Drosophila_2:1632998_at:608:45; Interrogation_Position=2675; Antisense; ATCCGCTTGCGTCCAGGTTAACAAA
>probe:Drosophila_2:1632998_at:634:363; Interrogation_Position=2727; Antisense; GAATCATCGCCAACTACTTTATCTA
>probe:Drosophila_2:1632998_at:310:377; Interrogation_Position=2760; Antisense; GAAGCACTTGGATTCGACCTTGCAG
>probe:Drosophila_2:1632998_at:487:637; Interrogation_Position=2869; Antisense; TCGATGCTCGGACAAGTGCTGCGCA
>probe:Drosophila_2:1632998_at:143:509; Interrogation_Position=2884; Antisense; GTGCTGCGCACTTTTATTGAGAAAT
>probe:Drosophila_2:1632998_at:188:5; Interrogation_Position=2899; Antisense; ATTGAGAAATTGGTGCGCCGCTCCT
>probe:Drosophila_2:1632998_at:391:401; Interrogation_Position=2946; Antisense; GACTTTGGAACAGTTGCCACCGGCG
>probe:Drosophila_2:1632998_at:442:727; Interrogation_Position=2986; Antisense; TTGTGTCTCCAACCTCAGGACATAG
>probe:Drosophila_2:1632998_at:512:25; Interrogation_Position=3007; Antisense; ATAGGCCGTGTCATCAGTCTGTGTT
>probe:Drosophila_2:1632998_at:584:17; Interrogation_Position=3041; Antisense; ATTTCCTCGGAAACAGTCACTTGGG
>probe:Drosophila_2:1632998_at:146:529; Interrogation_Position=3063; Antisense; GGGAGTTGCTCCGATAGAACCACAA
>probe:Drosophila_2:1632998_at:128:33; Interrogation_Position=3127; Antisense; ATCAAGTCCGCGTCATAGTTCAAAT
>probe:Drosophila_2:1632998_at:133:103; Interrogation_Position=3181; Antisense; AGAGCCTTGTACTCGTTGGTAAGCA

Paste this into a BLAST search page for me
GGGTGTGGACAAACCTCATCCGCTTATCCGCTTGCGTCCAGGTTAACAAAGAATCATCGCCAACTACTTTATCTAGAAGCACTTGGATTCGACCTTGCAGTCGATGCTCGGACAAGTGCTGCGCAGTGCTGCGCACTTTTATTGAGAAATATTGAGAAATTGGTGCGCCGCTCCTGACTTTGGAACAGTTGCCACCGGCGTTGTGTCTCCAACCTCAGGACATAGATAGGCCGTGTCATCAGTCTGTGTTATTTCCTCGGAAACAGTCACTTGGGGGGAGTTGCTCCGATAGAACCACAAATCAAGTCCGCGTCATAGTTCAAATAGAGCCTTGTACTCGTTGGTAAGCA

Full Affymetrix probeset data:

Annotations for 1632998_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720