FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632999_at:

>probe:Drosophila_2:1632999_at:272:645; Interrogation_Position=520; Antisense; TCTAGAGCGACGAATTGCCGATATT
>probe:Drosophila_2:1632999_at:365:593; Interrogation_Position=577; Antisense; TGAGGAGTGCGCCAACGATCTAAGC
>probe:Drosophila_2:1632999_at:124:525; Interrogation_Position=628; Antisense; GGCCGCCGTCAAGCTTACCAAAAAG
>probe:Drosophila_2:1632999_at:400:181; Interrogation_Position=647; Antisense; AAAAAGATGGCCCTGCTCGTGACCA
>probe:Drosophila_2:1632999_at:412:365; Interrogation_Position=676; Antisense; GAATATGTCCAGTGGCTTTCGCTAT
>probe:Drosophila_2:1632999_at:430:635; Interrogation_Position=706; Antisense; TCGATATCTACGACATGCCCTGATC
>probe:Drosophila_2:1632999_at:575:449; Interrogation_Position=727; Antisense; GATCGCTCGACATATCAACGACTTT
>probe:Drosophila_2:1632999_at:101:199; Interrogation_Position=743; Antisense; AACGACTTTCGCTACGAGATCGCCG
>probe:Drosophila_2:1632999_at:165:43; Interrogation_Position=803; Antisense; ATCGATGGGCGACTGGACCAGATCA
>probe:Drosophila_2:1632999_at:566:463; Interrogation_Position=843; Antisense; GATTCGGAGTCGTATTCTCGACCAC
>probe:Drosophila_2:1632999_at:452:327; Interrogation_Position=871; Antisense; GCGTCAATCCAATCTAATCGCCGAT
>probe:Drosophila_2:1632999_at:166:383; Interrogation_Position=897; Antisense; GAACTGGCAACACTGAGCTAACCGA
>probe:Drosophila_2:1632999_at:362:659; Interrogation_Position=915; Antisense; TAACCGAGCTAACTGATGCCACCGA
>probe:Drosophila_2:1632999_at:108:197; Interrogation_Position=940; Antisense; AACGTTCACCGTTCCAAGGAGCAAT

Paste this into a BLAST search page for me
TCTAGAGCGACGAATTGCCGATATTTGAGGAGTGCGCCAACGATCTAAGCGGCCGCCGTCAAGCTTACCAAAAAGAAAAAGATGGCCCTGCTCGTGACCAGAATATGTCCAGTGGCTTTCGCTATTCGATATCTACGACATGCCCTGATCGATCGCTCGACATATCAACGACTTTAACGACTTTCGCTACGAGATCGCCGATCGATGGGCGACTGGACCAGATCAGATTCGGAGTCGTATTCTCGACCACGCGTCAATCCAATCTAATCGCCGATGAACTGGCAACACTGAGCTAACCGATAACCGAGCTAACTGATGCCACCGAAACGTTCACCGTTCCAAGGAGCAAT

Full Affymetrix probeset data:

Annotations for 1632999_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720