FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633001_at:

>probe:Drosophila_2:1633001_at:670:167; Interrogation_Position=455; Antisense; AAATGTGGCAACTCGATCCATTCAC
>probe:Drosophila_2:1633001_at:460:683; Interrogation_Position=504; Antisense; TATCCGCCGAGCTTTGAGGCACTCG
>probe:Drosophila_2:1633001_at:106:235; Interrogation_Position=549; Antisense; AATCCGCACTATCTGGATCCGGAGG
>probe:Drosophila_2:1633001_at:610:573; Interrogation_Position=610; Antisense; GGCTGGAGGAGTTCGTCGCATACCA
>probe:Drosophila_2:1633001_at:462:429; Interrogation_Position=618; Antisense; GAGTTCGTCGCATACCATGGACTGC
>probe:Drosophila_2:1633001_at:217:405; Interrogation_Position=637; Antisense; GACTGCCCGTGCTGGGTCTTCGCGA
>probe:Drosophila_2:1633001_at:428:631; Interrogation_Position=697; Antisense; TCCTCCTGGGCGATCGCAATGCCAA
>probe:Drosophila_2:1633001_at:87:637; Interrogation_Position=710; Antisense; TCGCAATGCCAAGCTGTTCAAGGCT
>probe:Drosophila_2:1633001_at:253:603; Interrogation_Position=724; Antisense; TGTTCAAGGCTGACGGTGGCACCGA
>probe:Drosophila_2:1633001_at:562:437; Interrogation_Position=747; Antisense; GAGGAGCTAGCACCCCTAGCGGATC
>probe:Drosophila_2:1633001_at:322:673; Interrogation_Position=763; Antisense; TAGCGGATCTCACCTTCCTGCTGCA
>probe:Drosophila_2:1633001_at:299:185; Interrogation_Position=878; Antisense; AACAATTCCTACACGTAAGCAGTAC
>probe:Drosophila_2:1633001_at:519:659; Interrogation_Position=893; Antisense; TAAGCAGTACACATACAGTAGTTGT
>probe:Drosophila_2:1633001_at:530:483; Interrogation_Position=954; Antisense; GTATAACCCCTGACGAGTGTACATA

Paste this into a BLAST search page for me
AAATGTGGCAACTCGATCCATTCACTATCCGCCGAGCTTTGAGGCACTCGAATCCGCACTATCTGGATCCGGAGGGGCTGGAGGAGTTCGTCGCATACCAGAGTTCGTCGCATACCATGGACTGCGACTGCCCGTGCTGGGTCTTCGCGATCCTCCTGGGCGATCGCAATGCCAATCGCAATGCCAAGCTGTTCAAGGCTTGTTCAAGGCTGACGGTGGCACCGAGAGGAGCTAGCACCCCTAGCGGATCTAGCGGATCTCACCTTCCTGCTGCAAACAATTCCTACACGTAAGCAGTACTAAGCAGTACACATACAGTAGTTGTGTATAACCCCTGACGAGTGTACATA

Full Affymetrix probeset data:

Annotations for 1633001_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720