FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633002_at:

>probe:Drosophila_2:1633002_at:92:13; Interrogation_Position=1541; Antisense; ATTAAGTACGATCCCTTGCCTAATG
>probe:Drosophila_2:1633002_at:723:67; Interrogation_Position=1581; Antisense; AGGCCAAGGGCTTCGAGGTCATCTT
>probe:Drosophila_2:1633002_at:619:629; Interrogation_Position=1658; Antisense; TCGCTGGAAGCTCCCAAGGAACTTA
>probe:Drosophila_2:1633002_at:324:707; Interrogation_Position=1680; Antisense; TTACCACCGCATTCGATAGCAATCG
>probe:Drosophila_2:1633002_at:281:27; Interrogation_Position=1695; Antisense; ATAGCAATCGCGACTTTTCCATCTA
>probe:Drosophila_2:1633002_at:182:721; Interrogation_Position=1711; Antisense; TTCCATCTACGACACATCTTTTTAC
>probe:Drosophila_2:1633002_at:229:663; Interrogation_Position=1739; Antisense; TACAAGGTCCTAGGTGCTCTTCTAG
>probe:Drosophila_2:1633002_at:196:595; Interrogation_Position=1772; Antisense; TGGGCCATTCCCATGAGCTATGTGT
>probe:Drosophila_2:1633002_at:474:609; Interrogation_Position=1785; Antisense; TGAGCTATGTGTGGCCCTTGGACAA
>probe:Drosophila_2:1633002_at:447:299; Interrogation_Position=1839; Antisense; CGCCATTCGTGCGTAGCATGTTGAA
>probe:Drosophila_2:1633002_at:107:127; Interrogation_Position=1866; Antisense; AGCCAAGTCCAGTTTTGGAGCTCGA
>probe:Drosophila_2:1633002_at:459:73; Interrogation_Position=1890; Antisense; AGGAATTGCCTCTGAAGACGCCGCT
>probe:Drosophila_2:1633002_at:395:103; Interrogation_Position=1905; Antisense; AGACGCCGCTTTCCGAAGAGCAAAT
>probe:Drosophila_2:1633002_at:47:129; Interrogation_Position=1971; Antisense; ACCACATCTGTACATTTGCATTCGA

Paste this into a BLAST search page for me
ATTAAGTACGATCCCTTGCCTAATGAGGCCAAGGGCTTCGAGGTCATCTTTCGCTGGAAGCTCCCAAGGAACTTATTACCACCGCATTCGATAGCAATCGATAGCAATCGCGACTTTTCCATCTATTCCATCTACGACACATCTTTTTACTACAAGGTCCTAGGTGCTCTTCTAGTGGGCCATTCCCATGAGCTATGTGTTGAGCTATGTGTGGCCCTTGGACAACGCCATTCGTGCGTAGCATGTTGAAAGCCAAGTCCAGTTTTGGAGCTCGAAGGAATTGCCTCTGAAGACGCCGCTAGACGCCGCTTTCCGAAGAGCAAATACCACATCTGTACATTTGCATTCGA

Full Affymetrix probeset data:

Annotations for 1633002_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720