Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633003_at:

>probe:Drosophila_2:1633003_at:439:665; Interrogation_Position=1447; Antisense; TACAGTTGACCTTGGATCGGCTACC
>probe:Drosophila_2:1633003_at:331:639; Interrogation_Position=1463; Antisense; TCGGCTACCGCTCGATTATGTCAAT
>probe:Drosophila_2:1633003_at:597:681; Interrogation_Position=1479; Antisense; TATGTCAATCCCCTGGTCAACGAAC
>probe:Drosophila_2:1633003_at:571:257; Interrogation_Position=1578; Antisense; CACACTAGTGTCTTGATGTCCGAGG
>probe:Drosophila_2:1633003_at:643:347; Interrogation_Position=1657; Antisense; GCATGCACTGTCTATCGGAAGCTTT
>probe:Drosophila_2:1633003_at:42:659; Interrogation_Position=1687; Antisense; TAACCGGGCGAGTCAACCTGATAAT
>probe:Drosophila_2:1633003_at:596:199; Interrogation_Position=1723; Antisense; AACGCAACGCGGACAATCATCTCAA
>probe:Drosophila_2:1633003_at:460:659; Interrogation_Position=1751; Antisense; TAACAAAGCCCTGATCCTGGACGAA
>probe:Drosophila_2:1633003_at:157:67; Interrogation_Position=1838; Antisense; AGGCAGTCCGAAGAGCCCATTGGAA
>probe:Drosophila_2:1633003_at:704:135; Interrogation_Position=1882; Antisense; ACGACCTGGCGACCGACGATGGTAA
>probe:Drosophila_2:1633003_at:274:441; Interrogation_Position=1899; Antisense; GATGGTAACGCCGACGCAGACACAG
>probe:Drosophila_2:1633003_at:162:155; Interrogation_Position=1920; Antisense; ACAGACTCTGACGTATCCATGGATT
>probe:Drosophila_2:1633003_at:621:399; Interrogation_Position=1946; Antisense; GACAGTCTACCCGTAATTTAAGCTT
>probe:Drosophila_2:1633003_at:306:231; Interrogation_Position=1972; Antisense; AATGCAATTCCCTTGTTGTTGCGCC

Paste this into a BLAST search page for me
TACAGTTGACCTTGGATCGGCTACCTCGGCTACCGCTCGATTATGTCAATTATGTCAATCCCCTGGTCAACGAACCACACTAGTGTCTTGATGTCCGAGGGCATGCACTGTCTATCGGAAGCTTTTAACCGGGCGAGTCAACCTGATAATAACGCAACGCGGACAATCATCTCAATAACAAAGCCCTGATCCTGGACGAAAGGCAGTCCGAAGAGCCCATTGGAAACGACCTGGCGACCGACGATGGTAAGATGGTAACGCCGACGCAGACACAGACAGACTCTGACGTATCCATGGATTGACAGTCTACCCGTAATTTAAGCTTAATGCAATTCCCTTGTTGTTGCGCC

Full Affymetrix probeset data:

Annotations for 1633003_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime