FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633004_at:

>probe:Drosophila_2:1633004_at:257:685; Interrogation_Position=1050; Antisense; TATAAATAATAGAGCGCCAAGTGAT
>probe:Drosophila_2:1633004_at:132:125; Interrogation_Position=1062; Antisense; AGCGCCAAGTGATTTCGTCGCACAA
>probe:Drosophila_2:1633004_at:514:219; Interrogation_Position=1068; Antisense; AAGTGATTTCGTCGCACAACGCTAT
>probe:Drosophila_2:1633004_at:454:707; Interrogation_Position=1115; Antisense; TTACGTTGTAAAATCCATGCCGGGG
>probe:Drosophila_2:1633004_at:496:181; Interrogation_Position=1198; Antisense; AAAAAAGCACTTGCGCTGACAATCC
>probe:Drosophila_2:1633004_at:31:113; Interrogation_Position=1203; Antisense; AGCACTTGCGCTGACAATCCTACAA
>probe:Drosophila_2:1633004_at:268:723; Interrogation_Position=1208; Antisense; TTGCGCTGACAATCCTACAAGCAAT
>probe:Drosophila_2:1633004_at:530:333; Interrogation_Position=1212; Antisense; GCTGACAATCCTACAAGCAATATTA
>probe:Drosophila_2:1633004_at:236:155; Interrogation_Position=734; Antisense; ACAGATCGATCTTCGACAAGACGAT
>probe:Drosophila_2:1633004_at:363:637; Interrogation_Position=739; Antisense; TCGATCTTCGACAAGACGATTGGAG
>probe:Drosophila_2:1633004_at:605:397; Interrogation_Position=748; Antisense; GACAAGACGATTGGAGGCAACAGGA
>probe:Drosophila_2:1633004_at:364:265; Interrogation_Position=882; Antisense; CAGTCGTCCGTCTTTGGGCTTTGAG
>probe:Drosophila_2:1633004_at:228:639; Interrogation_Position=885; Antisense; TCGTCCGTCTTTGGGCTTTGAGTAT
>probe:Drosophila_2:1633004_at:524:277; Interrogation_Position=893; Antisense; CTTTGGGCTTTGAGTATAGCAAACC

Paste this into a BLAST search page for me
TATAAATAATAGAGCGCCAAGTGATAGCGCCAAGTGATTTCGTCGCACAAAAGTGATTTCGTCGCACAACGCTATTTACGTTGTAAAATCCATGCCGGGGAAAAAAGCACTTGCGCTGACAATCCAGCACTTGCGCTGACAATCCTACAATTGCGCTGACAATCCTACAAGCAATGCTGACAATCCTACAAGCAATATTAACAGATCGATCTTCGACAAGACGATTCGATCTTCGACAAGACGATTGGAGGACAAGACGATTGGAGGCAACAGGACAGTCGTCCGTCTTTGGGCTTTGAGTCGTCCGTCTTTGGGCTTTGAGTATCTTTGGGCTTTGAGTATAGCAAACC

Full Affymetrix probeset data:

Annotations for 1633004_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720