FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633005_at:

>probe:Drosophila_2:1633005_at:276:205; Interrogation_Position=1733; Antisense; AAGCGTTGTGCAAGTGCTGCTCGGC
>probe:Drosophila_2:1633005_at:259:725; Interrogation_Position=1780; Antisense; TTGTGCATCCCAACTTTCAGTCAAG
>probe:Drosophila_2:1633005_at:628:647; Interrogation_Position=1796; Antisense; TCAGTCAAGGATCCGTCGCTGGACA
>probe:Drosophila_2:1633005_at:168:275; Interrogation_Position=1844; Antisense; CATTGGCGGTGCTCTGTGCGGATTC
>probe:Drosophila_2:1633005_at:36:13; Interrogation_Position=1865; Antisense; ATTCTCTCGTGAGGGCGGCGCCATA
>probe:Drosophila_2:1633005_at:191:187; Interrogation_Position=1896; Antisense; AACAAGAACCTTTGGTCGCTGTCCT
>probe:Drosophila_2:1633005_at:30:469; Interrogation_Position=1949; Antisense; GTTGATTCTCTCACTGATGTACTAC
>probe:Drosophila_2:1633005_at:530:57; Interrogation_Position=1965; Antisense; ATGTACTACTTCATCGACGTGCGGG
>probe:Drosophila_2:1633005_at:172:51; Interrogation_Position=2024; Antisense; ATGCGGCATGAACGCCATCGTGATG
>probe:Drosophila_2:1633005_at:392:271; Interrogation_Position=2039; Antisense; CATCGTGATGTACGTGGGCCACTCA
>probe:Drosophila_2:1633005_at:36:87; Interrogation_Position=2063; Antisense; AGTGCTGCACAAGATGCTGCCCTGG
>probe:Drosophila_2:1633005_at:553:41; Interrogation_Position=2097; Antisense; ATCGGCGAGATGAACACGCACTTCA
>probe:Drosophila_2:1633005_at:331:287; Interrogation_Position=2178; Antisense; CTGGACGCGCAGGAATTCTACTACA
>probe:Drosophila_2:1633005_at:402:81; Interrogation_Position=2209; Antisense; AGGGCCACACGAGAGTAACCATATG

Paste this into a BLAST search page for me
AAGCGTTGTGCAAGTGCTGCTCGGCTTGTGCATCCCAACTTTCAGTCAAGTCAGTCAAGGATCCGTCGCTGGACACATTGGCGGTGCTCTGTGCGGATTCATTCTCTCGTGAGGGCGGCGCCATAAACAAGAACCTTTGGTCGCTGTCCTGTTGATTCTCTCACTGATGTACTACATGTACTACTTCATCGACGTGCGGGATGCGGCATGAACGCCATCGTGATGCATCGTGATGTACGTGGGCCACTCAAGTGCTGCACAAGATGCTGCCCTGGATCGGCGAGATGAACACGCACTTCACTGGACGCGCAGGAATTCTACTACAAGGGCCACACGAGAGTAACCATATG

Full Affymetrix probeset data:

Annotations for 1633005_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720