Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633006_at:

>probe:Drosophila_2:1633006_at:586:111; Interrogation_Position=103; Antisense; AGCAAAGGACACAGCCAATCCGCAA
>probe:Drosophila_2:1633006_at:707:73; Interrogation_Position=108; Antisense; AGGACACAGCCAATCCGCAACAGCA
>probe:Drosophila_2:1633006_at:714:65; Interrogation_Position=13; Antisense; ATGGAGGCGAGCTCGAATCCCACAA
>probe:Drosophila_2:1633006_at:663:621; Interrogation_Position=164; Antisense; TGCTGACCACCAGTCTGGAAATGCC
>probe:Drosophila_2:1633006_at:230:265; Interrogation_Position=174; Antisense; CAGTCTGGAAATGCCCAAGACGGAG
>probe:Drosophila_2:1633006_at:70:549; Interrogation_Position=195; Antisense; GGAGGATCTGTACAATCTGTCCGTA
>probe:Drosophila_2:1633006_at:340:451; Interrogation_Position=199; Antisense; GATCTGTACAATCTGTCCGTAGCCA
>probe:Drosophila_2:1633006_at:37:237; Interrogation_Position=208; Antisense; AATCTGTCCGTAGCCAGCGGACTAT
>probe:Drosophila_2:1633006_at:382:675; Interrogation_Position=218; Antisense; TAGCCAGCGGACTATCCGAGGGACA
>probe:Drosophila_2:1633006_at:421:683; Interrogation_Position=230; Antisense; TATCCGAGGGACAGAGATCGCTCTC
>probe:Drosophila_2:1633006_at:42:155; Interrogation_Position=240; Antisense; ACAGAGATCGCTCTCGGGCGCTCCG
>probe:Drosophila_2:1633006_at:456:629; Interrogation_Position=274; Antisense; TCCAGTCCCATTATGAGTCCGCAGG
>probe:Drosophila_2:1633006_at:447:13; Interrogation_Position=283; Antisense; ATTATGAGTCCGCAGGGCAAGATCT
>probe:Drosophila_2:1633006_at:413:643; Interrogation_Position=305; Antisense; TCTTTGGAAGGAATGCGAATGGAAC

Paste this into a BLAST search page for me
AGCAAAGGACACAGCCAATCCGCAAAGGACACAGCCAATCCGCAACAGCAATGGAGGCGAGCTCGAATCCCACAATGCTGACCACCAGTCTGGAAATGCCCAGTCTGGAAATGCCCAAGACGGAGGGAGGATCTGTACAATCTGTCCGTAGATCTGTACAATCTGTCCGTAGCCAAATCTGTCCGTAGCCAGCGGACTATTAGCCAGCGGACTATCCGAGGGACATATCCGAGGGACAGAGATCGCTCTCACAGAGATCGCTCTCGGGCGCTCCGTCCAGTCCCATTATGAGTCCGCAGGATTATGAGTCCGCAGGGCAAGATCTTCTTTGGAAGGAATGCGAATGGAAC

Full Affymetrix probeset data:

Annotations for 1633006_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime