FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633007_at:

>probe:Drosophila_2:1633007_at:548:423; Interrogation_Position=241; Antisense; GAGAAACCCTTACCCATCATGGTTT
>probe:Drosophila_2:1633007_at:313:273; Interrogation_Position=357; Antisense; CATTGGACATCGCTTGGGACTTTTC
>probe:Drosophila_2:1633007_at:349:403; Interrogation_Position=374; Antisense; GACTTTTCGGATTTCTCAACTTTGC
>probe:Drosophila_2:1633007_at:82:193; Interrogation_Position=391; Antisense; AACTTTGCTGATCCCTCGCTAGATG
>probe:Drosophila_2:1633007_at:497:699; Interrogation_Position=443; Antisense; TTATTATGGCCCTTCGTTGGATTAA
>probe:Drosophila_2:1633007_at:346:15; Interrogation_Position=482; Antisense; ATTTTAATGGTGTCCCCGATAGAAT
>probe:Drosophila_2:1633007_at:219:27; Interrogation_Position=500; Antisense; ATAGAATCACCATCTTTGGCCACAG
>probe:Drosophila_2:1633007_at:69:283; Interrogation_Position=525; Antisense; CTCCGGCAGCGCGTTGGTTAATATG
>probe:Drosophila_2:1633007_at:678:653; Interrogation_Position=543; Antisense; TAATATGCTCTTGGCTAGTCCGCAA
>probe:Drosophila_2:1633007_at:558:563; Interrogation_Position=570; Antisense; GGAAGGGCTCTTCCATAAGGCCATC
>probe:Drosophila_2:1633007_at:719:709; Interrogation_Position=609; Antisense; TTCAGCCGCAATTGGAGTACCGTTT
>probe:Drosophila_2:1633007_at:88:125; Interrogation_Position=671; Antisense; AGCCAGGTTTTTGAGTTCCTACTGA
>probe:Drosophila_2:1633007_at:413:227; Interrogation_Position=695; Antisense; AAGGCTGATCCAAAACTGCTCGTTT
>probe:Drosophila_2:1633007_at:347:479; Interrogation_Position=716; Antisense; GTTTCTGCTGACGTTTTTAGCCCAG

Paste this into a BLAST search page for me
GAGAAACCCTTACCCATCATGGTTTCATTGGACATCGCTTGGGACTTTTCGACTTTTCGGATTTCTCAACTTTGCAACTTTGCTGATCCCTCGCTAGATGTTATTATGGCCCTTCGTTGGATTAAATTTTAATGGTGTCCCCGATAGAATATAGAATCACCATCTTTGGCCACAGCTCCGGCAGCGCGTTGGTTAATATGTAATATGCTCTTGGCTAGTCCGCAAGGAAGGGCTCTTCCATAAGGCCATCTTCAGCCGCAATTGGAGTACCGTTTAGCCAGGTTTTTGAGTTCCTACTGAAAGGCTGATCCAAAACTGCTCGTTTGTTTCTGCTGACGTTTTTAGCCCAG

Full Affymetrix probeset data:

Annotations for 1633007_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720