Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633008_at:

>probe:Drosophila_2:1633008_at:64:565; Interrogation_Position=1302; Antisense; TACGCCGGGCTACCAAAGAATTCGA
>probe:Drosophila_2:1633008_at:511:623; Interrogation_Position=1329; Antisense; TGCCCGGATCGGTGTTTGTAATTGC
>probe:Drosophila_2:1633008_at:568:229; Interrogation_Position=1364; Antisense; AATGTGCTGATACCAACGGCGGCGA
>probe:Drosophila_2:1633008_at:569:573; Interrogation_Position=1384; Antisense; GGCGATACACATGGATCCTGGCATT
>probe:Drosophila_2:1633008_at:538:403; Interrogation_Position=1426; Antisense; GTTCTACCCGGAGCGCTTTGAGGAA
>probe:Drosophila_2:1633008_at:576:67; Interrogation_Position=1497; Antisense; ATGGCCTGCGAGGATGCATTGCCGC
>probe:Drosophila_2:1633008_at:360:341; Interrogation_Position=1524; Antisense; GCTTTGCAGAGCAGCAGCTTCTGGT
>probe:Drosophila_2:1633008_at:594:551; Interrogation_Position=1594; Antisense; GGAGACCTCGATTCCCGTGGAGTAC
>probe:Drosophila_2:1633008_at:687:547; Interrogation_Position=1612; Antisense; GGAGTACGACAACCGGAGACTGCTC
>probe:Drosophila_2:1633008_at:650:423; Interrogation_Position=1627; Antisense; GAGACTGCTCTTGATGCCCAAGTCG
>probe:Drosophila_2:1633008_at:269:217; Interrogation_Position=1646; Antisense; AAGTCGGACATCAAACTCAGTGTGG
>probe:Drosophila_2:1633008_at:440:333; Interrogation_Position=1701; Antisense; GCTGGAGCATCGCATATTTTGTATT
>probe:Drosophila_2:1633008_at:249:617; Interrogation_Position=1768; Antisense; TGCACCTTTTTCGTTGATTTTCCTA
>probe:Drosophila_2:1633008_at:656:31; Interrogation_Position=1831; Antisense; ATAATCTTTTGCACCAAGCTCAACA

Paste this into a BLAST search page for me
TACGCCGGGCTACCAAAGAATTCGATGCCCGGATCGGTGTTTGTAATTGCAATGTGCTGATACCAACGGCGGCGAGGCGATACACATGGATCCTGGCATTGTTCTACCCGGAGCGCTTTGAGGAAATGGCCTGCGAGGATGCATTGCCGCGCTTTGCAGAGCAGCAGCTTCTGGTGGAGACCTCGATTCCCGTGGAGTACGGAGTACGACAACCGGAGACTGCTCGAGACTGCTCTTGATGCCCAAGTCGAAGTCGGACATCAAACTCAGTGTGGGCTGGAGCATCGCATATTTTGTATTTGCACCTTTTTCGTTGATTTTCCTAATAATCTTTTGCACCAAGCTCAACA

Full Affymetrix probeset data:

Annotations for 1633008_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime