Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633010_s_at:

>probe:Drosophila_2:1633010_s_at:613:405; Interrogation_Position=148; Antisense; GACTGTGCCGTGGTGGCCACCCAAA
>probe:Drosophila_2:1633010_s_at:522:185; Interrogation_Position=190; Antisense; AACATCGTGCCTGAAACGGTGACCC
>probe:Drosophila_2:1633010_s_at:119:603; Interrogation_Position=218; Antisense; TGTTCCGCATCACCAAGGACATTGG
>probe:Drosophila_2:1633010_s_at:318:361; Interrogation_Position=247; Antisense; GCAATGACCGGACGCATAGCTGATT
>probe:Drosophila_2:1633010_s_at:657:603; Interrogation_Position=267; Antisense; TGATTCCCGCTCACAGGTGCAGAAG
>probe:Drosophila_2:1633010_s_at:340:395; Interrogation_Position=334; Antisense; GAAATGCCCGTGGATGTGCTGTGTC
>probe:Drosophila_2:1633010_s_at:86:349; Interrogation_Position=422; Antisense; GCATGGTGCTGATCGCTTACGACAA
>probe:Drosophila_2:1633010_s_at:470:393; Interrogation_Position=448; Antisense; GAAATCGGCCCCAGCGTTTACAAGA
>probe:Drosophila_2:1633010_s_at:505:667; Interrogation_Position=487; Antisense; TACTTCAGCGGGTTCAAGGCCTGCA
>probe:Drosophila_2:1633010_s_at:61:405; Interrogation_Position=525; Antisense; GACTCTGGAGGCCAACAGCTATCTG
>probe:Drosophila_2:1633010_s_at:575:551; Interrogation_Position=579; Antisense; GGAGAAAGCGATCCAGCTGGCCATC
>probe:Drosophila_2:1633010_s_at:333:309; Interrogation_Position=614; Antisense; CCAGTGTGCTCGCTATAGACTTCAA
>probe:Drosophila_2:1633010_s_at:638:95; Interrogation_Position=653; Antisense; AGATCGGCGTGGTCAGCAAGTCTGA
>probe:Drosophila_2:1633010_s_at:25:219; Interrogation_Position=670; Antisense; AAGTCTGATCCCACTTTCCGTATTT

Paste this into a BLAST search page for me
GACTGTGCCGTGGTGGCCACCCAAAAACATCGTGCCTGAAACGGTGACCCTGTTCCGCATCACCAAGGACATTGGGCAATGACCGGACGCATAGCTGATTTGATTCCCGCTCACAGGTGCAGAAGGAAATGCCCGTGGATGTGCTGTGTCGCATGGTGCTGATCGCTTACGACAAGAAATCGGCCCCAGCGTTTACAAGATACTTCAGCGGGTTCAAGGCCTGCAGACTCTGGAGGCCAACAGCTATCTGGGAGAAAGCGATCCAGCTGGCCATCCCAGTGTGCTCGCTATAGACTTCAAAGATCGGCGTGGTCAGCAAGTCTGAAAGTCTGATCCCACTTTCCGTATTT

Full Affymetrix probeset data:

Annotations for 1633010_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime