Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633011_at:

>probe:Drosophila_2:1633011_at:349:247; Interrogation_Position=3309; Antisense; AATTGATGATTCCTTGAACTCTATA
>probe:Drosophila_2:1633011_at:55:613; Interrogation_Position=3323; Antisense; TGAACTCTATAAAAACCATCGCATT
>probe:Drosophila_2:1633011_at:78:655; Interrogation_Position=3385; Antisense; TAATTTTAACGTTCATAGGCGTACA
>probe:Drosophila_2:1633011_at:136:679; Interrogation_Position=3400; Antisense; TAGGCGTACATTATATACTTTTGAA
>probe:Drosophila_2:1633011_at:694:217; Interrogation_Position=3471; Antisense; AAGTCTAATTATGTAAGCGAGTGAT
>probe:Drosophila_2:1633011_at:349:417; Interrogation_Position=3496; Antisense; GAGCGTAGGTGGTAAACATTAAACA
>probe:Drosophila_2:1633011_at:721:27; Interrogation_Position=3707; Antisense; ATACAAATTACGCATACCTACCACA
>probe:Drosophila_2:1633011_at:109:673; Interrogation_Position=3715; Antisense; TACGCATACCTACCACAACATATAT
>probe:Drosophila_2:1633011_at:107:33; Interrogation_Position=3742; Antisense; ATAATACATGCAGCGTACATACGAA
>probe:Drosophila_2:1633011_at:256:265; Interrogation_Position=3754; Antisense; GCGTACATACGAACATAAGTAACGG
>probe:Drosophila_2:1633011_at:578:491; Interrogation_Position=3847; Antisense; GTAACATAAGTACGACAGGTTCAGA
>probe:Drosophila_2:1633011_at:151:91; Interrogation_Position=3855; Antisense; AGTACGACAGGTTCAGAGAGTTTAA
>probe:Drosophila_2:1633011_at:126:425; Interrogation_Position=3870; Antisense; GAGAGTTTAACCAGGAGTCCCTCGA
>probe:Drosophila_2:1633011_at:134:203; Interrogation_Position=3878; Antisense; AACCAGGAGTCCCTCGATCCCATTT

Paste this into a BLAST search page for me
AATTGATGATTCCTTGAACTCTATATGAACTCTATAAAAACCATCGCATTTAATTTTAACGTTCATAGGCGTACATAGGCGTACATTATATACTTTTGAAAAGTCTAATTATGTAAGCGAGTGATGAGCGTAGGTGGTAAACATTAAACAATACAAATTACGCATACCTACCACATACGCATACCTACCACAACATATATATAATACATGCAGCGTACATACGAAGCGTACATACGAACATAAGTAACGGGTAACATAAGTACGACAGGTTCAGAAGTACGACAGGTTCAGAGAGTTTAAGAGAGTTTAACCAGGAGTCCCTCGAAACCAGGAGTCCCTCGATCCCATTT

Full Affymetrix probeset data:

Annotations for 1633011_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime