FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633012_at:

>probe:Drosophila_2:1633012_at:468:71; Interrogation_Position=1087; Antisense; AGGCTAGGCAACAGGCCTGAGCTTT
>probe:Drosophila_2:1633012_at:586:541; Interrogation_Position=1124; Antisense; GGATCTTTTAAGCTACAACACCCAT
>probe:Drosophila_2:1633012_at:149:155; Interrogation_Position=1199; Antisense; ACAGAGCCATGCCTACAAGTCTAGA
>probe:Drosophila_2:1633012_at:627:207; Interrogation_Position=1214; Antisense; CAAGTCTAGATCTGGTTACCACTGG
>probe:Drosophila_2:1633012_at:374:475; Interrogation_Position=1228; Antisense; GTTACCACTGGTTAGCAGGACACAC
>probe:Drosophila_2:1633012_at:604:543; Interrogation_Position=1266; Antisense; GGATATATCATCATTGGCCAAGCGA
>probe:Drosophila_2:1633012_at:62:581; Interrogation_Position=1280; Antisense; TGGCCAAGCGAGTTTAGCAAATTAT
>probe:Drosophila_2:1633012_at:75:389; Interrogation_Position=1328; Antisense; GAAAATGTACCTAGAACGCAATCAA
>probe:Drosophila_2:1633012_at:569:229; Interrogation_Position=1385; Antisense; AATGTATTAGCCTCGAGGGCGGATT
>probe:Drosophila_2:1633012_at:96:429; Interrogation_Position=1423; Antisense; GAGATTGGATCGGTACACGCGCACA
>probe:Drosophila_2:1633012_at:37:285; Interrogation_Position=1454; Antisense; CTGCGGCATTCCAAGTACATATTTT
>probe:Drosophila_2:1633012_at:124:23; Interrogation_Position=1483; Antisense; ATATGCTCTTAAACTCTATTCTAAC
>probe:Drosophila_2:1633012_at:281:79; Interrogation_Position=1562; Antisense; AGGGCGGAAAACATGGCAACTATCA
>probe:Drosophila_2:1633012_at:33:177; Interrogation_Position=1647; Antisense; AAACGCGAATTTGTGATCTTTAGCA

Paste this into a BLAST search page for me
AGGCTAGGCAACAGGCCTGAGCTTTGGATCTTTTAAGCTACAACACCCATACAGAGCCATGCCTACAAGTCTAGACAAGTCTAGATCTGGTTACCACTGGGTTACCACTGGTTAGCAGGACACACGGATATATCATCATTGGCCAAGCGATGGCCAAGCGAGTTTAGCAAATTATGAAAATGTACCTAGAACGCAATCAAAATGTATTAGCCTCGAGGGCGGATTGAGATTGGATCGGTACACGCGCACACTGCGGCATTCCAAGTACATATTTTATATGCTCTTAAACTCTATTCTAACAGGGCGGAAAACATGGCAACTATCAAAACGCGAATTTGTGATCTTTAGCA

Full Affymetrix probeset data:

Annotations for 1633012_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720