Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633017_at:

>probe:Drosophila_2:1633017_at:576:373; Interrogation_Position=1782; Antisense; GAAGTATGTCGTCGGCAATCTCACC
>probe:Drosophila_2:1633017_at:293:651; Interrogation_Position=1807; Antisense; TCAAATTGGTTGACTCCTGGAAATC
>probe:Drosophila_2:1633017_at:362:77; Interrogation_Position=1835; Antisense; AGGATTTCCGGGTGTTGTGCCCATA
>probe:Drosophila_2:1633017_at:383:609; Interrogation_Position=1869; Antisense; TGAGAAGCGCTCCAACTTCGAGTAC
>probe:Drosophila_2:1633017_at:118:431; Interrogation_Position=1888; Antisense; GAGTACTGCTACCTGCATTGGACCA
>probe:Drosophila_2:1633017_at:202:607; Interrogation_Position=1925; Antisense; TGATGACGCACAACTCTTCGCTGAC
>probe:Drosophila_2:1633017_at:712:191; Interrogation_Position=1969; Antisense; AACTCTTTGCGCGATATGGATCAGT
>probe:Drosophila_2:1633017_at:146:431; Interrogation_Position=2013; Antisense; GAGTGAGACGCGTCCATTTACCCTA
>probe:Drosophila_2:1633017_at:595:17; Interrogation_Position=2028; Antisense; ATTTACCCTATACGGCATCTTCGAT
>probe:Drosophila_2:1633017_at:482:185; Interrogation_Position=2059; Antisense; AACAATGTGTTGTTCCGTGACGACA
>probe:Drosophila_2:1633017_at:5:511; Interrogation_Position=2075; Antisense; GTGACGACACCGATGGCCTACTGGG
>probe:Drosophila_2:1633017_at:691:355; Interrogation_Position=2142; Antisense; GCACATCTACGATCGGTATGCCAAT
>probe:Drosophila_2:1633017_at:347:15; Interrogation_Position=2247; Antisense; ATTTGTAGTGGGTCAGCCGTTTGGC
>probe:Drosophila_2:1633017_at:28:133; Interrogation_Position=2275; Antisense; ACCCGAGCTCAACACTAATCTTATT

Paste this into a BLAST search page for me
GAAGTATGTCGTCGGCAATCTCACCTCAAATTGGTTGACTCCTGGAAATCAGGATTTCCGGGTGTTGTGCCCATATGAGAAGCGCTCCAACTTCGAGTACGAGTACTGCTACCTGCATTGGACCATGATGACGCACAACTCTTCGCTGACAACTCTTTGCGCGATATGGATCAGTGAGTGAGACGCGTCCATTTACCCTAATTTACCCTATACGGCATCTTCGATAACAATGTGTTGTTCCGTGACGACAGTGACGACACCGATGGCCTACTGGGGCACATCTACGATCGGTATGCCAATATTTGTAGTGGGTCAGCCGTTTGGCACCCGAGCTCAACACTAATCTTATT

Full Affymetrix probeset data:

Annotations for 1633017_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime