Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633020_at:

>probe:Drosophila_2:1633020_at:498:553; Interrogation_Position=3791; Antisense; GGAGCTGTTGAGTCGCAAATCTATT
>probe:Drosophila_2:1633020_at:495:295; Interrogation_Position=3804; Antisense; CGCAAATCTATTGTGTGTATTACCA
>probe:Drosophila_2:1633020_at:240:615; Interrogation_Position=3844; Antisense; TGAATGCATACCTCTCTCAGAATAT
>probe:Drosophila_2:1633020_at:343:111; Interrogation_Position=3862; Antisense; AGAATATCACTGACTCTCATCACCG
>probe:Drosophila_2:1633020_at:222:279; Interrogation_Position=3877; Antisense; CTCATCACCGGAGACACAGTTTGAA
>probe:Drosophila_2:1633020_at:400:17; Interrogation_Position=3912; Antisense; ATTTACTTTATGAATCTCCACGAGA
>probe:Drosophila_2:1633020_at:710:627; Interrogation_Position=3928; Antisense; TCCACGAGATGTACATGGGATGTCT
>probe:Drosophila_2:1633020_at:471:547; Interrogation_Position=3945; Antisense; GGATGTCTATCGAACTACGCGTTTT
>probe:Drosophila_2:1633020_at:23:359; Interrogation_Position=3997; Antisense; GCAAAGCAATTTTACAACATGTCAA
>probe:Drosophila_2:1633020_at:562:211; Interrogation_Position=4020; Antisense; AAGAAATCCATTTCACGCCATCTCA
>probe:Drosophila_2:1633020_at:209:135; Interrogation_Position=4034; Antisense; ACGCCATCTCAACTGTGAAGAATCA
>probe:Drosophila_2:1633020_at:482:397; Interrogation_Position=4114; Antisense; GACACATGTATTTTGTATACGCTAC
>probe:Drosophila_2:1633020_at:16:483; Interrogation_Position=4128; Antisense; GTATACGCTACTGTAAGAGTGATTT
>probe:Drosophila_2:1633020_at:200:391; Interrogation_Position=4165; Antisense; GAAACTACTTGAATATGTGATCCAG

Paste this into a BLAST search page for me
GGAGCTGTTGAGTCGCAAATCTATTCGCAAATCTATTGTGTGTATTACCATGAATGCATACCTCTCTCAGAATATAGAATATCACTGACTCTCATCACCGCTCATCACCGGAGACACAGTTTGAAATTTACTTTATGAATCTCCACGAGATCCACGAGATGTACATGGGATGTCTGGATGTCTATCGAACTACGCGTTTTGCAAAGCAATTTTACAACATGTCAAAAGAAATCCATTTCACGCCATCTCAACGCCATCTCAACTGTGAAGAATCAGACACATGTATTTTGTATACGCTACGTATACGCTACTGTAAGAGTGATTTGAAACTACTTGAATATGTGATCCAG

Full Affymetrix probeset data:

Annotations for 1633020_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime