Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633021_s_at:

>probe:Drosophila_2:1633021_s_at:405:489; Interrogation_Position=123; Antisense; GTACAATTAACGTCCTTCGAAATAG
>probe:Drosophila_2:1633021_s_at:391:663; Interrogation_Position=14; Antisense; TAAACGGACGCGTTTTCGTCGCGAG
>probe:Drosophila_2:1633021_s_at:221:413; Interrogation_Position=157; Antisense; GAGTATTCCGGGTCGCGAGTATTTA
>probe:Drosophila_2:1633021_s_at:204:541; Interrogation_Position=189; Antisense; GGATTTGTGTATACCGAAAGGGCTA
>probe:Drosophila_2:1633021_s_at:499:395; Interrogation_Position=232; Antisense; GAAATTTGCATTTTCATCTTGCGCA
>probe:Drosophila_2:1633021_s_at:650:179; Interrogation_Position=277; Antisense; AAAAATGCTGACACCGATGAGGCCA
>probe:Drosophila_2:1633021_s_at:409:639; Interrogation_Position=29; Antisense; TCGTCGCGAGTTTAACCGCTGCAAA
>probe:Drosophila_2:1633021_s_at:575:467; Interrogation_Position=309; Antisense; GTTGATTGGCTGACAACCACGACGA
>probe:Drosophila_2:1633021_s_at:420:309; Interrogation_Position=325; Antisense; CCACGACGACGTCCACGGACGAGAA
>probe:Drosophila_2:1633021_s_at:619:117; Interrogation_Position=355; Antisense; AGCTAGACACGCTTCAGTGCATCGA
>probe:Drosophila_2:1633021_s_at:402:585; Interrogation_Position=397; Antisense; TGGAAGCGGATTTGCAGTTGACAGT
>probe:Drosophila_2:1633021_s_at:689:553; Interrogation_Position=424; Antisense; GGAGCCGGAGCAGCATCACCTGGCT
>probe:Drosophila_2:1633021_s_at:576:131; Interrogation_Position=441; Antisense; ACCTGGCTCCACTTGAGTACGAAAA
>probe:Drosophila_2:1633021_s_at:221:247; Interrogation_Position=73; Antisense; AATTGCCGCGGGTACTGAGTTCATA

Paste this into a BLAST search page for me
GTACAATTAACGTCCTTCGAAATAGTAAACGGACGCGTTTTCGTCGCGAGGAGTATTCCGGGTCGCGAGTATTTAGGATTTGTGTATACCGAAAGGGCTAGAAATTTGCATTTTCATCTTGCGCAAAAAATGCTGACACCGATGAGGCCATCGTCGCGAGTTTAACCGCTGCAAAGTTGATTGGCTGACAACCACGACGACCACGACGACGTCCACGGACGAGAAAGCTAGACACGCTTCAGTGCATCGATGGAAGCGGATTTGCAGTTGACAGTGGAGCCGGAGCAGCATCACCTGGCTACCTGGCTCCACTTGAGTACGAAAAAATTGCCGCGGGTACTGAGTTCATA

Full Affymetrix probeset data:

Annotations for 1633021_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime