FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633023_at:

>probe:Drosophila_2:1633023_at:697:245; Interrogation_Position=111; Antisense; AATTCCAAGCCCCAATCCTCGTGAT
>probe:Drosophila_2:1633023_at:381:203; Interrogation_Position=117; Antisense; AAGCCCCAATCCTCGTGATAAGTGG
>probe:Drosophila_2:1633023_at:30:47; Interrogation_Position=125; Antisense; ATCCTCGTGATAAGTGGTGCCGTCT
>probe:Drosophila_2:1633023_at:343:31; Interrogation_Position=134; Antisense; ATAAGTGGTGCCGTCTTAATTTGGG
>probe:Drosophila_2:1633023_at:443:389; Interrogation_Position=18; Antisense; GAAAACTCTAGCTCTATTCTTGGTT
>probe:Drosophila_2:1633023_at:421:189; Interrogation_Position=21; Antisense; AACTCTAGCTCTATTCTTGGTTCTC
>probe:Drosophila_2:1633023_at:332:675; Interrogation_Position=26; Antisense; TAGCTCTATTCTTGGTTCTCGTTTG
>probe:Drosophila_2:1633023_at:471:277; Interrogation_Position=31; Antisense; CTATTCTTGGTTCTCGTTTGCGTAC
>probe:Drosophila_2:1633023_at:687:723; Interrogation_Position=37; Antisense; TTGGTTCTCGTTTGCGTACTCGGCT
>probe:Drosophila_2:1633023_at:467:635; Interrogation_Position=44; Antisense; TCGTTTGCGTACTCGGCTTGGTCCA
>probe:Drosophila_2:1633023_at:512:667; Interrogation_Position=53; Antisense; TACTCGGCTTGGTCCAGGCCTGGGA
>probe:Drosophila_2:1633023_at:20:67; Interrogation_Position=78; Antisense; ATGGCCGTGGAATAGGAAGCCTACA
>probe:Drosophila_2:1633023_at:227:379; Interrogation_Position=93; Antisense; GAAGCCTACAAAGTTTCCAATTCCA
>probe:Drosophila_2:1633023_at:408:307; Interrogation_Position=96; Antisense; GCCTACAAAGTTTCCAATTCCAAGC

Paste this into a BLAST search page for me
AATTCCAAGCCCCAATCCTCGTGATAAGCCCCAATCCTCGTGATAAGTGGATCCTCGTGATAAGTGGTGCCGTCTATAAGTGGTGCCGTCTTAATTTGGGGAAAACTCTAGCTCTATTCTTGGTTAACTCTAGCTCTATTCTTGGTTCTCTAGCTCTATTCTTGGTTCTCGTTTGCTATTCTTGGTTCTCGTTTGCGTACTTGGTTCTCGTTTGCGTACTCGGCTTCGTTTGCGTACTCGGCTTGGTCCATACTCGGCTTGGTCCAGGCCTGGGAATGGCCGTGGAATAGGAAGCCTACAGAAGCCTACAAAGTTTCCAATTCCAGCCTACAAAGTTTCCAATTCCAAGC

Full Affymetrix probeset data:

Annotations for 1633023_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720