FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633025_at:

>probe:Drosophila_2:1633025_at:35:229; Interrogation_Position=104; Antisense; AATGGCGCACCGTCTATAGTATGCC
>probe:Drosophila_2:1633025_at:590:393; Interrogation_Position=162; Antisense; GAAAGTCTACCAGGCTGTCATCACG
>probe:Drosophila_2:1633025_at:82:37; Interrogation_Position=253; Antisense; ATCTATGCCGCCATTGGAGTCACTG
>probe:Drosophila_2:1633025_at:645:237; Interrogation_Position=316; Antisense; AATCTCGTGGGCTTCATCTACGTGA
>probe:Drosophila_2:1633025_at:628:187; Interrogation_Position=347; Antisense; AACAGGATCTGCTCAAGCTGGCCTA
>probe:Drosophila_2:1633025_at:699:153; Interrogation_Position=36; Antisense; ACAGAGACGCCGCTTTGCAACAGAG
>probe:Drosophila_2:1633025_at:148:529; Interrogation_Position=384; Antisense; GGGACGGCGACAGGAGACACTCATT
>probe:Drosophila_2:1633025_at:659:611; Interrogation_Position=408; Antisense; TGAAACCGAGGATCTGCTGCCGAGC
>probe:Drosophila_2:1633025_at:616:81; Interrogation_Position=440; Antisense; AGGGAAGTCCGTCTCGACTCAGATT
>probe:Drosophila_2:1633025_at:727:403; Interrogation_Position=455; Antisense; GACTCAGATTCGTTTCGCCCATTTG
>probe:Drosophila_2:1633025_at:709:19; Interrogation_Position=475; Antisense; ATTTGCTTGCGCAGCGATTCCAAAA
>probe:Drosophila_2:1633025_at:561:177; Interrogation_Position=508; Antisense; AAACTCCTTAATCGCTTCGGTCATG
>probe:Drosophila_2:1633025_at:292:717; Interrogation_Position=523; Antisense; TTCGGTCATGTCAGCGATCGCCAGT
>probe:Drosophila_2:1633025_at:650:449; Interrogation_Position=538; Antisense; GATCGCCAGTTGTTTGAGGGTCTCT

Paste this into a BLAST search page for me
AATGGCGCACCGTCTATAGTATGCCGAAAGTCTACCAGGCTGTCATCACGATCTATGCCGCCATTGGAGTCACTGAATCTCGTGGGCTTCATCTACGTGAAACAGGATCTGCTCAAGCTGGCCTAACAGAGACGCCGCTTTGCAACAGAGGGGACGGCGACAGGAGACACTCATTTGAAACCGAGGATCTGCTGCCGAGCAGGGAAGTCCGTCTCGACTCAGATTGACTCAGATTCGTTTCGCCCATTTGATTTGCTTGCGCAGCGATTCCAAAAAAACTCCTTAATCGCTTCGGTCATGTTCGGTCATGTCAGCGATCGCCAGTGATCGCCAGTTGTTTGAGGGTCTCT

Full Affymetrix probeset data:

Annotations for 1633025_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720