FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633029_at:

>probe:Drosophila_2:1633029_at:549:691; Interrogation_Position=1035; Antisense; TTTGACTTGGCCACTTACTATCGTG
>probe:Drosophila_2:1633029_at:193:521; Interrogation_Position=1057; Antisense; GTGGCAGCAAGTTGTACGTCCGTTG
>probe:Drosophila_2:1633029_at:525:475; Interrogation_Position=1161; Antisense; GTTACTCTGTTTTATATGCTCTGCG
>probe:Drosophila_2:1633029_at:4:53; Interrogation_Position=1176; Antisense; ATGCTCTGCGGTAAAATGCCCTTTG
>probe:Drosophila_2:1633029_at:155:51; Interrogation_Position=1191; Antisense; ATGCCCTTTGCTAGTGCCTGTAAAA
>probe:Drosophila_2:1633029_at:180:353; Interrogation_Position=1233; Antisense; GCAGCGATCATGAGCGGTGGACCCA
>probe:Drosophila_2:1633029_at:719:515; Interrogation_Position=1279; Antisense; GTGTCATGAGTCCAGAGGCTACCCA
>probe:Drosophila_2:1633029_at:503:439; Interrogation_Position=1293; Antisense; GAGGCTACCCAGTTGATCGACGGAC
>probe:Drosophila_2:1633029_at:697:43; Interrogation_Position=1308; Antisense; ATCGACGGACTGCTTGTGAGCGACC
>probe:Drosophila_2:1633029_at:180:161; Interrogation_Position=1363; Antisense; ACAAGTTCCAGTTCTTGGCCCTATA
>probe:Drosophila_2:1633029_at:701:579; Interrogation_Position=1378; Antisense; TGGCCCTATAGCGTTGTTCAAAATT
>probe:Drosophila_2:1633029_at:730:709; Interrogation_Position=859; Antisense; TTCAGAAGCGCGGTATCTTGTCGGA
>probe:Drosophila_2:1633029_at:706:581; Interrogation_Position=925; Antisense; TGGCGCATATGCACCAACTTCAGGT
>probe:Drosophila_2:1633029_at:151:111; Interrogation_Position=973; Antisense; AGAATCTGCTGGTTTGCTCTTCATC

Paste this into a BLAST search page for me
TTTGACTTGGCCACTTACTATCGTGGTGGCAGCAAGTTGTACGTCCGTTGGTTACTCTGTTTTATATGCTCTGCGATGCTCTGCGGTAAAATGCCCTTTGATGCCCTTTGCTAGTGCCTGTAAAAGCAGCGATCATGAGCGGTGGACCCAGTGTCATGAGTCCAGAGGCTACCCAGAGGCTACCCAGTTGATCGACGGACATCGACGGACTGCTTGTGAGCGACCACAAGTTCCAGTTCTTGGCCCTATATGGCCCTATAGCGTTGTTCAAAATTTTCAGAAGCGCGGTATCTTGTCGGATGGCGCATATGCACCAACTTCAGGTAGAATCTGCTGGTTTGCTCTTCATC

Full Affymetrix probeset data:

Annotations for 1633029_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720