FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633031_at:

>probe:Drosophila_2:1633031_at:377:653; Interrogation_Position=230; Antisense; TCAAGGGACGCTATGCCTCGTACAT
>probe:Drosophila_2:1633031_at:117:151; Interrogation_Position=251; Antisense; ACATCCGGATCGTGGCTGGTCAGAA
>probe:Drosophila_2:1633031_at:566:333; Interrogation_Position=265; Antisense; GCTGGTCAGAACTCGATTGCCGATC
>probe:Drosophila_2:1633031_at:327:459; Interrogation_Position=361; Antisense; GATATCGGTTTGATCATCACTCGCG
>probe:Drosophila_2:1633031_at:74:647; Interrogation_Position=374; Antisense; TCATCACTCGCGAGCCATTGGAGTA
>probe:Drosophila_2:1633031_at:200:3; Interrogation_Position=390; Antisense; ATTGGAGTACTCAGCCCTGGTGCAA
>probe:Drosophila_2:1633031_at:310:201; Interrogation_Position=413; Antisense; AACCCATTGCTGTGGCCCTGGAGGC
>probe:Drosophila_2:1633031_at:224:615; Interrogation_Position=486; Antisense; TGAAGATGATGAAGCTCTGCCCGCC
>probe:Drosophila_2:1633031_at:71:319; Interrogation_Position=520; Antisense; GCCGTTGAGCTGCAGATCATCGAGA
>probe:Drosophila_2:1633031_at:193:37; Interrogation_Position=535; Antisense; ATCATCGAGAAGAGCACCTGCGGTG
>probe:Drosophila_2:1633031_at:224:507; Interrogation_Position=557; Antisense; GTGCCCAGTATCTGACCAAGGACTA
>probe:Drosophila_2:1633031_at:628:259; Interrogation_Position=582; Antisense; CACGGTGACCGATGAGATGCTCTGC
>probe:Drosophila_2:1633031_at:9:225; Interrogation_Position=719; Antisense; AAGGATTCCCGGGTGTCTACACCAG
>probe:Drosophila_2:1633031_at:233:129; Interrogation_Position=739; Antisense; ACCAGCGTCAATTCCCATATCGATT

Paste this into a BLAST search page for me
TCAAGGGACGCTATGCCTCGTACATACATCCGGATCGTGGCTGGTCAGAAGCTGGTCAGAACTCGATTGCCGATCGATATCGGTTTGATCATCACTCGCGTCATCACTCGCGAGCCATTGGAGTAATTGGAGTACTCAGCCCTGGTGCAAAACCCATTGCTGTGGCCCTGGAGGCTGAAGATGATGAAGCTCTGCCCGCCGCCGTTGAGCTGCAGATCATCGAGAATCATCGAGAAGAGCACCTGCGGTGGTGCCCAGTATCTGACCAAGGACTACACGGTGACCGATGAGATGCTCTGCAAGGATTCCCGGGTGTCTACACCAGACCAGCGTCAATTCCCATATCGATT

Full Affymetrix probeset data:

Annotations for 1633031_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720