FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633037_at:

>probe:Drosophila_2:1633037_at:85:549; Interrogation_Position=2504; Antisense; GGAGGAGAACTTGGCCCAGCACCTT
>probe:Drosophila_2:1633037_at:574:421; Interrogation_Position=2582; Antisense; GAGAAAGAGGCGCTTCCGCTACCAG
>probe:Drosophila_2:1633037_at:430:7; Interrogation_Position=2614; Antisense; ATTGCTGGCGTTCCTTTGTCGTTCA
>probe:Drosophila_2:1633037_at:586:597; Interrogation_Position=2630; Antisense; TGTCGTTCAGCCCAGCCTGGATAAA
>probe:Drosophila_2:1633037_at:106:317; Interrogation_Position=2644; Antisense; GCCTGGATAAACACATTCGGGACAT
>probe:Drosophila_2:1633037_at:604:11; Interrogation_Position=2658; Antisense; ATTCGGGACATGCATGTGGCCAAGA
>probe:Drosophila_2:1633037_at:366:181; Interrogation_Position=2693; Antisense; AAAAAAGTATCTCTGCTCGCTGTGC
>probe:Drosophila_2:1633037_at:411:343; Interrogation_Position=2744; Antisense; GCTTAACATCCATATGCGGCGACAC
>probe:Drosophila_2:1633037_at:331:13; Interrogation_Position=2783; Antisense; ATTCAAGTGCGATCTCTGCGACATG
>probe:Drosophila_2:1633037_at:388:341; Interrogation_Position=2809; Antisense; GCTTCACGGTCCACTACGAGTTGAA
>probe:Drosophila_2:1633037_at:528:617; Interrogation_Position=2836; Antisense; TGCACCGTCGGAAGCATACTGGCGA
>probe:Drosophila_2:1633037_at:488:411; Interrogation_Position=2863; Antisense; GACCCTACCAATGCACGTTTTGCGA
>probe:Drosophila_2:1633037_at:150:403; Interrogation_Position=2892; Antisense; GACTTCGCTCGACCAGACAAACTAA
>probe:Drosophila_2:1633037_at:480:105; Interrogation_Position=2916; Antisense; AGACGGCACGTCTTCATGCACAACG

Paste this into a BLAST search page for me
GGAGGAGAACTTGGCCCAGCACCTTGAGAAAGAGGCGCTTCCGCTACCAGATTGCTGGCGTTCCTTTGTCGTTCATGTCGTTCAGCCCAGCCTGGATAAAGCCTGGATAAACACATTCGGGACATATTCGGGACATGCATGTGGCCAAGAAAAAAAGTATCTCTGCTCGCTGTGCGCTTAACATCCATATGCGGCGACACATTCAAGTGCGATCTCTGCGACATGGCTTCACGGTCCACTACGAGTTGAATGCACCGTCGGAAGCATACTGGCGAGACCCTACCAATGCACGTTTTGCGAGACTTCGCTCGACCAGACAAACTAAAGACGGCACGTCTTCATGCACAACG

Full Affymetrix probeset data:

Annotations for 1633037_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720