FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633038_at:

>probe:Drosophila_2:1633038_at:106:729; Interrogation_Position=1004; Antisense; TTGGAGGTCAGCGATTTGGCCTGCA
>probe:Drosophila_2:1633038_at:116:581; Interrogation_Position=1020; Antisense; TGGCCTGCAGCCCAGAGATTATGTA
>probe:Drosophila_2:1633038_at:402:315; Interrogation_Position=1079; Antisense; GCCTATCTGCTTTCACCTTAATGGA
>probe:Drosophila_2:1633038_at:391:229; Interrogation_Position=1098; Antisense; AATGGACGCGGAGTTCTGGATTCTG
>probe:Drosophila_2:1633038_at:531:287; Interrogation_Position=1113; Antisense; CTGGATTCTGGGAGACGTTTTCATC
>probe:Drosophila_2:1633038_at:404:715; Interrogation_Position=628; Antisense; TTCGAGAGCATGTGTGACCAGCAGC
>probe:Drosophila_2:1633038_at:376:479; Interrogation_Position=789; Antisense; GTATTGGCAGTTCCCTTTGGATGTC
>probe:Drosophila_2:1633038_at:447:431; Interrogation_Position=808; Antisense; GATGTCATTGAAGTTGCCGGTACTA
>probe:Drosophila_2:1633038_at:473:649; Interrogation_Position=840; Antisense; TCAGAATCGACAGGCCATCGCGGAT
>probe:Drosophila_2:1633038_at:448:543; Interrogation_Position=861; Antisense; GGATACGGGTACATCTCTCTTGGCA
>probe:Drosophila_2:1633038_at:418:709; Interrogation_Position=911; Antisense; TTAATAGTCTCCTTGGTGGCTTGCC
>probe:Drosophila_2:1633038_at:554:341; Interrogation_Position=929; Antisense; GCTTGCCCACCTCAAATAACGAATA
>probe:Drosophila_2:1633038_at:337:285; Interrogation_Position=963; Antisense; CTGTTCTGAGATCGATAGTTTGCCC
>probe:Drosophila_2:1633038_at:516:479; Interrogation_Position=980; Antisense; GTTTGCCCGAAATCGTGTTCATCAT

Paste this into a BLAST search page for me
TTGGAGGTCAGCGATTTGGCCTGCATGGCCTGCAGCCCAGAGATTATGTAGCCTATCTGCTTTCACCTTAATGGAAATGGACGCGGAGTTCTGGATTCTGCTGGATTCTGGGAGACGTTTTCATCTTCGAGAGCATGTGTGACCAGCAGCGTATTGGCAGTTCCCTTTGGATGTCGATGTCATTGAAGTTGCCGGTACTATCAGAATCGACAGGCCATCGCGGATGGATACGGGTACATCTCTCTTGGCATTAATAGTCTCCTTGGTGGCTTGCCGCTTGCCCACCTCAAATAACGAATACTGTTCTGAGATCGATAGTTTGCCCGTTTGCCCGAAATCGTGTTCATCAT

Full Affymetrix probeset data:

Annotations for 1633038_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720