FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633039_at:

>probe:Drosophila_2:1633039_at:123:485; Interrogation_Position=1041; Antisense; GTATGCTGTGTACATTGTTGTCAAC
>probe:Drosophila_2:1633039_at:467:241; Interrogation_Position=1138; Antisense; AATAGCTTTAATTGCCTCACTTTGT
>probe:Drosophila_2:1633039_at:496:477; Interrogation_Position=1167; Antisense; GTTTTATCGTATCAACACGGGCTTA
>probe:Drosophila_2:1633039_at:64:393; Interrogation_Position=1200; Antisense; GAAATGCACCTCAATTTTGTAAGCT
>probe:Drosophila_2:1633039_at:592:347; Interrogation_Position=694; Antisense; GCAGTCAGTCGGACGGATCCAGTGT
>probe:Drosophila_2:1633039_at:143:85; Interrogation_Position=714; Antisense; AGTGTGAACCTGCTGGTGACCACGC
>probe:Drosophila_2:1633039_at:423:431; Interrogation_Position=757; Antisense; GAGTCATCTCGTGGGTGTGTGTCAT
>probe:Drosophila_2:1633039_at:437:513; Interrogation_Position=775; Antisense; GTGTCATTCCGTTCGACGTGGTCAA
>probe:Drosophila_2:1633039_at:164:347; Interrogation_Position=838; Antisense; GCATCTTCCATTGCGTGCGGGTGCA
>probe:Drosophila_2:1633039_at:615:291; Interrogation_Position=851; Antisense; CGTGCGGGTGCAGTACAGAGCCTAC
>probe:Drosophila_2:1633039_at:566:415; Interrogation_Position=868; Antisense; GAGCCTACGGCTGGAGGAGCATCTT
>probe:Drosophila_2:1633039_at:342:147; Interrogation_Position=942; Antisense; ACTTTCCTGGGCTACGAGTATGCGC
>probe:Drosophila_2:1633039_at:662:507; Interrogation_Position=974; Antisense; GTGTCAGCGGTGGAACGGCACCTAC
>probe:Drosophila_2:1633039_at:191:563; Interrogation_Position=990; Antisense; GGCACCTACGTATGACCCAGGCAGT

Paste this into a BLAST search page for me
GTATGCTGTGTACATTGTTGTCAACAATAGCTTTAATTGCCTCACTTTGTGTTTTATCGTATCAACACGGGCTTAGAAATGCACCTCAATTTTGTAAGCTGCAGTCAGTCGGACGGATCCAGTGTAGTGTGAACCTGCTGGTGACCACGCGAGTCATCTCGTGGGTGTGTGTCATGTGTCATTCCGTTCGACGTGGTCAAGCATCTTCCATTGCGTGCGGGTGCACGTGCGGGTGCAGTACAGAGCCTACGAGCCTACGGCTGGAGGAGCATCTTACTTTCCTGGGCTACGAGTATGCGCGTGTCAGCGGTGGAACGGCACCTACGGCACCTACGTATGACCCAGGCAGT

Full Affymetrix probeset data:

Annotations for 1633039_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720