FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633042_at:

>probe:Drosophila_2:1633042_at:57:255; Interrogation_Position=1032; Antisense; CAAACTCGCTAACTTCCTGGAAATC
>probe:Drosophila_2:1633042_at:75:465; Interrogation_Position=1057; Antisense; GATTGTTTTGTCCTGATCGGTTGCC
>probe:Drosophila_2:1633042_at:626:451; Interrogation_Position=1071; Antisense; GATCGGTTGCCCGTTCAATAATATG
>probe:Drosophila_2:1633042_at:683:489; Interrogation_Position=1110; Antisense; GTACTATAAGCCCATTGTCTCTGTC
>probe:Drosophila_2:1633042_at:710:425; Interrogation_Position=1173; Antisense; GAGATACCCCGAAGCTTATGTTACG
>probe:Drosophila_2:1633042_at:105:543; Interrogation_Position=1197; Antisense; GGATTTCAAACAACTTCTGCCGGAA
>probe:Drosophila_2:1633042_at:532:225; Interrogation_Position=1220; Antisense; AAGGACGCAGCTTCTTGCCTTTTGA
>probe:Drosophila_2:1633042_at:728:409; Interrogation_Position=1298; Antisense; GAGCGGTCAACGATTCCCTGGAAAC
>probe:Drosophila_2:1633042_at:373:559; Interrogation_Position=1317; Antisense; GGAAACAGGTGGAGATCCCGCCTCG
>probe:Drosophila_2:1633042_at:130:229; Interrogation_Position=1365; Antisense; AATGGCTCTCATGACGACGGATACC
>probe:Drosophila_2:1633042_at:574:715; Interrogation_Position=1399; Antisense; TTCGAGGATCGCACCTGGCAGGGAT
>probe:Drosophila_2:1633042_at:644:541; Interrogation_Position=1420; Antisense; GGATTGGATCCTGCCCTTGGACAGA
>probe:Drosophila_2:1633042_at:92:707; Interrogation_Position=946; Antisense; TTAGATGTGGTGACGCGACTGCAAA
>probe:Drosophila_2:1633042_at:187:213; Interrogation_Position=994; Antisense; AAGACGCAGCTTATTTCCGTGGGCA

Paste this into a BLAST search page for me
CAAACTCGCTAACTTCCTGGAAATCGATTGTTTTGTCCTGATCGGTTGCCGATCGGTTGCCCGTTCAATAATATGGTACTATAAGCCCATTGTCTCTGTCGAGATACCCCGAAGCTTATGTTACGGGATTTCAAACAACTTCTGCCGGAAAAGGACGCAGCTTCTTGCCTTTTGAGAGCGGTCAACGATTCCCTGGAAACGGAAACAGGTGGAGATCCCGCCTCGAATGGCTCTCATGACGACGGATACCTTCGAGGATCGCACCTGGCAGGGATGGATTGGATCCTGCCCTTGGACAGATTAGATGTGGTGACGCGACTGCAAAAAGACGCAGCTTATTTCCGTGGGCA

Full Affymetrix probeset data:

Annotations for 1633042_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720