Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633043_at:

>probe:Drosophila_2:1633043_at:501:165; Interrogation_Position=1590; Antisense; AAATCTCAACACATTGCGTCCACGA
>probe:Drosophila_2:1633043_at:44:329; Interrogation_Position=1605; Antisense; GCGTCCACGAATTCTTCAAGTTCTG
>probe:Drosophila_2:1633043_at:304:217; Interrogation_Position=1622; Antisense; AAGTTCTGCGGAAGGGCTCCATCAG
>probe:Drosophila_2:1633043_at:113:463; Interrogation_Position=1735; Antisense; GATTCTTTTGTCATGGCCACTGCAG
>probe:Drosophila_2:1633043_at:117:355; Interrogation_Position=1793; Antisense; GCACCAGGCTGTTGGAACCCATTAT
>probe:Drosophila_2:1633043_at:223:69; Interrogation_Position=1816; Antisense; ATGGCCCTTCAAATTGTGGCGCCTA
>probe:Drosophila_2:1633043_at:186:321; Interrogation_Position=1834; Antisense; GCGCCTAGCGAACGTATTTCCGGAA
>probe:Drosophila_2:1633043_at:614:13; Interrogation_Position=1858; Antisense; ATTATGGCGGATCTTTCACGGCGAC
>probe:Drosophila_2:1633043_at:673:575; Interrogation_Position=1877; Antisense; GGCGACGAGCCCTGATTAACGATGT
>probe:Drosophila_2:1633043_at:386:659; Interrogation_Position=1893; Antisense; TAACGATGTCTTACCCAAAGGCGAA
>probe:Drosophila_2:1633043_at:70:463; Interrogation_Position=1929; Antisense; GATTCTGGTGAATGCTCCTTTGGCA
>probe:Drosophila_2:1633043_at:629:671; Interrogation_Position=1979; Antisense; TACGCACGATAAGTTCCGGCACAGC
>probe:Drosophila_2:1633043_at:716:201; Interrogation_Position=2018; Antisense; AACCGTGTGGCTTCTCTTCAATGAA
>probe:Drosophila_2:1633043_at:498:245; Interrogation_Position=2041; Antisense; AATTCCGTGGACGAATCGCTGGCGG

Paste this into a BLAST search page for me
AAATCTCAACACATTGCGTCCACGAGCGTCCACGAATTCTTCAAGTTCTGAAGTTCTGCGGAAGGGCTCCATCAGGATTCTTTTGTCATGGCCACTGCAGGCACCAGGCTGTTGGAACCCATTATATGGCCCTTCAAATTGTGGCGCCTAGCGCCTAGCGAACGTATTTCCGGAAATTATGGCGGATCTTTCACGGCGACGGCGACGAGCCCTGATTAACGATGTTAACGATGTCTTACCCAAAGGCGAAGATTCTGGTGAATGCTCCTTTGGCATACGCACGATAAGTTCCGGCACAGCAACCGTGTGGCTTCTCTTCAATGAAAATTCCGTGGACGAATCGCTGGCGG

Full Affymetrix probeset data:

Annotations for 1633043_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime