FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633044_at:

>probe:Drosophila_2:1633044_at:636:325; Interrogation_Position=148; Antisense; GCGAGCACTCTGGTGGCTACAAGGT
>probe:Drosophila_2:1633044_at:677:663; Interrogation_Position=165; Antisense; TACAAGGTGTGGAAGCGCCTGTCCT
>probe:Drosophila_2:1633044_at:714:299; Interrogation_Position=206; Antisense; CGCCGTGGGACTGTGCATGCTGAAC
>probe:Drosophila_2:1633044_at:75:509; Interrogation_Position=218; Antisense; GTGCATGCTGAACGCCTACCTGAAG
>probe:Drosophila_2:1633044_at:262:149; Interrogation_Position=24; Antisense; ACAGCAAATTTTCATTCGGGCCAAG
>probe:Drosophila_2:1633044_at:422:203; Interrogation_Position=261; Antisense; AAGCCCCGCCAGGAGTTCGTCAAGT
>probe:Drosophila_2:1633044_at:171:469; Interrogation_Position=275; Antisense; GTTCGTCAAGTACGACTACCTGCGC
>probe:Drosophila_2:1633044_at:469:579; Interrogation_Position=330; Antisense; GGCCAGAAGAGCCTGTTCCACAACC
>probe:Drosophila_2:1633044_at:105:141; Interrogation_Position=376; Antisense; ACGGCTACGAGCACTAGGTGGCCAC
>probe:Drosophila_2:1633044_at:207:307; Interrogation_Position=413; Antisense; CCTCTGCGGGATGTATTCGTTGTTT
>probe:Drosophila_2:1633044_at:21:257; Interrogation_Position=501; Antisense; CAAACTCCAGTTGGCGCTTCAATAA
>probe:Drosophila_2:1633044_at:166:551; Interrogation_Position=543; Antisense; GGAGAGATCCCATAAAGACCATTTC
>probe:Drosophila_2:1633044_at:645:413; Interrogation_Position=559; Antisense; GACCATTTCAATGAGCGACAGCGGA
>probe:Drosophila_2:1633044_at:390:25; Interrogation_Position=61; Antisense; ATATGTCCGCTATTCTAAACCACGC

Paste this into a BLAST search page for me
GCGAGCACTCTGGTGGCTACAAGGTTACAAGGTGTGGAAGCGCCTGTCCTCGCCGTGGGACTGTGCATGCTGAACGTGCATGCTGAACGCCTACCTGAAGACAGCAAATTTTCATTCGGGCCAAGAAGCCCCGCCAGGAGTTCGTCAAGTGTTCGTCAAGTACGACTACCTGCGCGGCCAGAAGAGCCTGTTCCACAACCACGGCTACGAGCACTAGGTGGCCACCCTCTGCGGGATGTATTCGTTGTTTCAAACTCCAGTTGGCGCTTCAATAAGGAGAGATCCCATAAAGACCATTTCGACCATTTCAATGAGCGACAGCGGAATATGTCCGCTATTCTAAACCACGC

Full Affymetrix probeset data:

Annotations for 1633044_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720