FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633046_at:

>probe:Drosophila_2:1633046_at:163:153; Interrogation_Position=1191; Antisense; ACAGGTATCGGCATCGGTTCCGGCT
>probe:Drosophila_2:1633046_at:168:331; Interrogation_Position=1283; Antisense; GCGGTCGTCCATTCGGATCTGTGAA
>probe:Drosophila_2:1633046_at:126:439; Interrogation_Position=1330; Antisense; GAGGCGCTCTACATGGAGGAAGTTC
>probe:Drosophila_2:1633046_at:482:391; Interrogation_Position=1358; Antisense; GAAAGAACCAGCTGCTCTACGAACA
>probe:Drosophila_2:1633046_at:92:257; Interrogation_Position=1381; Antisense; CAAACCAAGATATGTCGGCAGCGAC
>probe:Drosophila_2:1633046_at:20:381; Interrogation_Position=1417; Antisense; GAACGCAAGGTCGACCTCATGCAGA
>probe:Drosophila_2:1633046_at:697:309; Interrogation_Position=1451; Antisense; CCAAGTGTCTTGAGCAGCAGGCGCA
>probe:Drosophila_2:1633046_at:460:115; Interrogation_Position=1466; Antisense; AGCAGGCGCAGATTCTGAGCCACGT
>probe:Drosophila_2:1633046_at:697:609; Interrogation_Position=1481; Antisense; TGAGCCACGTCCTTCAGCTGCAGAA
>probe:Drosophila_2:1633046_at:72:613; Interrogation_Position=1540; Antisense; TGAACTCCTTTTCCGACTTTTCATA
>probe:Drosophila_2:1633046_at:513:659; Interrogation_Position=1563; Antisense; TAACCTCAATTTTGGACCGCAGTGC
>probe:Drosophila_2:1633046_at:25:511; Interrogation_Position=1584; Antisense; GTGCACGAACACTGGTTTTCAGATA
>probe:Drosophila_2:1633046_at:442:589; Interrogation_Position=1610; Antisense; TGGATTGCTGCAACATGCCGCTTCG
>probe:Drosophila_2:1633046_at:83:267; Interrogation_Position=1635; Antisense; CAGGCTGATCGGTGCCACGAAACTT

Paste this into a BLAST search page for me
ACAGGTATCGGCATCGGTTCCGGCTGCGGTCGTCCATTCGGATCTGTGAAGAGGCGCTCTACATGGAGGAAGTTCGAAAGAACCAGCTGCTCTACGAACACAAACCAAGATATGTCGGCAGCGACGAACGCAAGGTCGACCTCATGCAGACCAAGTGTCTTGAGCAGCAGGCGCAAGCAGGCGCAGATTCTGAGCCACGTTGAGCCACGTCCTTCAGCTGCAGAATGAACTCCTTTTCCGACTTTTCATATAACCTCAATTTTGGACCGCAGTGCGTGCACGAACACTGGTTTTCAGATATGGATTGCTGCAACATGCCGCTTCGCAGGCTGATCGGTGCCACGAAACTT

Full Affymetrix probeset data:

Annotations for 1633046_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720