FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633047_at:

>probe:Drosophila_2:1633047_at:189:161; Interrogation_Position=1093; Antisense; ACAAGGGATTCTTTCTCTTCGTCGA
>probe:Drosophila_2:1633047_at:481:81; Interrogation_Position=1117; Antisense; AGGGTGCTCGTATCGACATGGCCCA
>probe:Drosophila_2:1633047_at:299:83; Interrogation_Position=1191; Antisense; AGGGCTGTCCAGAAGGCTCGCGAAC
>probe:Drosophila_2:1633047_at:177:613; Interrogation_Position=1229; Antisense; TGACACACTGATCGTGGTGACCGCT
>probe:Drosophila_2:1633047_at:146:513; Interrogation_Position=1245; Antisense; GTGACCGCTGATCATGCTCATGTTA
>probe:Drosophila_2:1633047_at:359:95; Interrogation_Position=1303; Antisense; AGATCACCGGATTGGCTCAACTGGC
>probe:Drosophila_2:1633047_at:497:287; Interrogation_Position=1323; Antisense; CTGGCGGATGATAATCTGCCCTATA
>probe:Drosophila_2:1633047_at:355:625; Interrogation_Position=1339; Antisense; TGCCCTATACGATTTTGTCCTATGC
>probe:Drosophila_2:1633047_at:406:467; Interrogation_Position=1427; Antisense; GTTGGTTGCGGACTCAGACTATCAG
>probe:Drosophila_2:1633047_at:379:489; Interrogation_Position=1532; Antisense; GTACTTCAGTGGCAACTACGAGCAA
>probe:Drosophila_2:1633047_at:579:243; Interrogation_Position=1560; Antisense; AATATTCCGGCGCTGATGGCCAGAG
>probe:Drosophila_2:1633047_at:566:575; Interrogation_Position=1597; Antisense; GGCCCTATGCCTAGGATTTGGCTGA
>probe:Drosophila_2:1633047_at:345:21; Interrogation_Position=1612; Antisense; ATTTGGCTGATTTTCTTGGCGCATG
>probe:Drosophila_2:1633047_at:306:61; Interrogation_Position=1634; Antisense; ATGTAAAACTCCTCTCGCTGAGATG

Paste this into a BLAST search page for me
ACAAGGGATTCTTTCTCTTCGTCGAAGGGTGCTCGTATCGACATGGCCCAAGGGCTGTCCAGAAGGCTCGCGAACTGACACACTGATCGTGGTGACCGCTGTGACCGCTGATCATGCTCATGTTAAGATCACCGGATTGGCTCAACTGGCCTGGCGGATGATAATCTGCCCTATATGCCCTATACGATTTTGTCCTATGCGTTGGTTGCGGACTCAGACTATCAGGTACTTCAGTGGCAACTACGAGCAAAATATTCCGGCGCTGATGGCCAGAGGGCCCTATGCCTAGGATTTGGCTGAATTTGGCTGATTTTCTTGGCGCATGATGTAAAACTCCTCTCGCTGAGATG

Full Affymetrix probeset data:

Annotations for 1633047_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720