FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633048_at:

>probe:Drosophila_2:1633048_at:500:671; Interrogation_Position=1694; Antisense; TTCGTGACTTCGCTGAACCCGGGAC
>probe:Drosophila_2:1633048_at:445:201; Interrogation_Position=1784; Antisense; AACCTGGATGCCAATCGTCCGGCGG
>probe:Drosophila_2:1633048_at:560:429; Interrogation_Position=1829; Antisense; GAGTTCAACTTCTGCGGCTGCGGCT
>probe:Drosophila_2:1633048_at:450:49; Interrogation_Position=1865; Antisense; ATGCTGGTGCCAAAGGGTCTGCCCG
>probe:Drosophila_2:1633048_at:665:81; Interrogation_Position=1890; Antisense; AGGGACTGCAGTGCGTGCTGTTCAT
>probe:Drosophila_2:1633048_at:595:329; Interrogation_Position=1902; Antisense; GCGTGCTGTTCATCATGGTGTCGAA
>probe:Drosophila_2:1633048_at:455:423; Interrogation_Position=1931; Antisense; GAGAACGACAGGATTGACCAGCAAT
>probe:Drosophila_2:1633048_at:367:671; Interrogation_Position=2009; Antisense; TACCCGGATCGCCAGTCCATGGGAT
>probe:Drosophila_2:1633048_at:410:61; Interrogation_Position=2027; Antisense; ATGGGATTCCCCTTCGACAGGTTGC
>probe:Drosophila_2:1633048_at:303:431; Interrogation_Position=2061; Antisense; GAGTCGACCGCCTGGTTAACTTCCT
>probe:Drosophila_2:1633048_at:485:115; Interrogation_Position=2099; Antisense; AGCATCGTGGACGTGAACATCCGCC
>probe:Drosophila_2:1633048_at:317:179; Interrogation_Position=2149; Antisense; AAACTAGACGATCCGCACCTGATTC
>probe:Drosophila_2:1633048_at:200:635; Interrogation_Position=2209; Antisense; TCGCCCACTTCTAGATATACAACTC
>probe:Drosophila_2:1633048_at:304:7; Interrogation_Position=2244; Antisense; ATTGCATCTTTATTGAGCCGCTTAA

Paste this into a BLAST search page for me
TTCGTGACTTCGCTGAACCCGGGACAACCTGGATGCCAATCGTCCGGCGGGAGTTCAACTTCTGCGGCTGCGGCTATGCTGGTGCCAAAGGGTCTGCCCGAGGGACTGCAGTGCGTGCTGTTCATGCGTGCTGTTCATCATGGTGTCGAAGAGAACGACAGGATTGACCAGCAATTACCCGGATCGCCAGTCCATGGGATATGGGATTCCCCTTCGACAGGTTGCGAGTCGACCGCCTGGTTAACTTCCTAGCATCGTGGACGTGAACATCCGCCAAACTAGACGATCCGCACCTGATTCTCGCCCACTTCTAGATATACAACTCATTGCATCTTTATTGAGCCGCTTAA

Full Affymetrix probeset data:

Annotations for 1633048_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720