FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633049_at:

>probe:Drosophila_2:1633049_at:429:649; Interrogation_Position=101; Antisense; TCACGCGTTGTCAGTTGGCCAAGGA
>probe:Drosophila_2:1633049_at:138:581; Interrogation_Position=14; Antisense; TGGCCAGTCACTTGCCCAAAGGTGG
>probe:Drosophila_2:1633049_at:494:277; Interrogation_Position=141; Antisense; CTTTCCCCGCAGTTATCTATCAAAT
>probe:Drosophila_2:1633049_at:327:255; Interrogation_Position=161; Antisense; CAAATTGGGTTTGCCTGGTGGAAGC
>probe:Drosophila_2:1633049_at:708:163; Interrogation_Position=208; Antisense; AAATCTATGCAGCTGCCCAATCAGA
>probe:Drosophila_2:1633049_at:251:103; Interrogation_Position=230; Antisense; AGAGCGTCAGCTACGGTCTGTTTCA
>probe:Drosophila_2:1633049_at:80:249; Interrogation_Position=268; Antisense; AATTGGTGTCGCAAAGGTCGTCGTG
>probe:Drosophila_2:1633049_at:341:501; Interrogation_Position=284; Antisense; GTCGTCGTGGCGGAATCTGCAACAT
>probe:Drosophila_2:1633049_at:222:445; Interrogation_Position=331; Antisense; GATGAGATCTCGGATGACTCGCGAT
>probe:Drosophila_2:1633049_at:48:57; Interrogation_Position=344; Antisense; ATGACTCGCGATGTGCCATGCAGAT
>probe:Drosophila_2:1633049_at:304:53; Interrogation_Position=361; Antisense; ATGCAGATTTTCAACCGCCACGGAT
>probe:Drosophila_2:1633049_at:510:317; Interrogation_Position=391; Antisense; GCCTGGCCCGGATGGATGAGCAAAT
>probe:Drosophila_2:1633049_at:689:37; Interrogation_Position=59; Antisense; ATCTTCTCCTGCTTTCGCAATGGGA
>probe:Drosophila_2:1633049_at:497:551; Interrogation_Position=81; Antisense; GGAGACCGAGTCTAAGCTGCTCACG

Paste this into a BLAST search page for me
TCACGCGTTGTCAGTTGGCCAAGGATGGCCAGTCACTTGCCCAAAGGTGGCTTTCCCCGCAGTTATCTATCAAATCAAATTGGGTTTGCCTGGTGGAAGCAAATCTATGCAGCTGCCCAATCAGAAGAGCGTCAGCTACGGTCTGTTTCAAATTGGTGTCGCAAAGGTCGTCGTGGTCGTCGTGGCGGAATCTGCAACATGATGAGATCTCGGATGACTCGCGATATGACTCGCGATGTGCCATGCAGATATGCAGATTTTCAACCGCCACGGATGCCTGGCCCGGATGGATGAGCAAATATCTTCTCCTGCTTTCGCAATGGGAGGAGACCGAGTCTAAGCTGCTCACG

Full Affymetrix probeset data:

Annotations for 1633049_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720