FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633050_at:

>probe:Drosophila_2:1633050_at:433:29; Interrogation_Position=118; Antisense; AAACCTTTTCCGCTTGAGGTGCGTG
>probe:Drosophila_2:1633050_at:487:329; Interrogation_Position=138; Antisense; GCGTGTGCACAATTGCGTTACTCCA
>probe:Drosophila_2:1633050_at:252:709; Interrogation_Position=155; Antisense; TTACTCCACCCTGTCAGATTGTGAA
>probe:Drosophila_2:1633050_at:400:637; Interrogation_Position=197; Antisense; TCGAGATCGATTTCGCCGTGGACAA
>probe:Drosophila_2:1633050_at:304:657; Interrogation_Position=21; Antisense; TAAGGTGTTGGTTCTGATCTCCCTA
>probe:Drosophila_2:1633050_at:125:521; Interrogation_Position=214; Antisense; GTGGACAAGTACATCACCCAGCTGA
>probe:Drosophila_2:1633050_at:654:145; Interrogation_Position=261; Antisense; ACTCGGAATCATTACGGTGCCATAT
>probe:Drosophila_2:1633050_at:573:535; Interrogation_Position=276; Antisense; GGTGCCATATGAACTGCCTGCGGAT
>probe:Drosophila_2:1633050_at:668:547; Interrogation_Position=360; Antisense; GGATGTCTCCTATTTGTTCACCTTT
>probe:Drosophila_2:1633050_at:555:693; Interrogation_Position=382; Antisense; TTTCCCATTGGTGAATATCCCGAGA
>probe:Drosophila_2:1633050_at:342:397; Interrogation_Position=442; Antisense; GACAATGAGATTGCCACGTGCTTCG
>probe:Drosophila_2:1633050_at:633:357; Interrogation_Position=491; Antisense; GCAACGGCGGCAATACGGTCTATGA
>probe:Drosophila_2:1633050_at:186:689; Interrogation_Position=50; Antisense; TATTACTATCGCTGGCTGAGGCTCA
>probe:Drosophila_2:1633050_at:573:419; Interrogation_Position=79; Antisense; GAGCATCCGGCGACATCTGTGAAGA

Paste this into a BLAST search page for me
AAACCTTTTCCGCTTGAGGTGCGTGGCGTGTGCACAATTGCGTTACTCCATTACTCCACCCTGTCAGATTGTGAATCGAGATCGATTTCGCCGTGGACAATAAGGTGTTGGTTCTGATCTCCCTAGTGGACAAGTACATCACCCAGCTGAACTCGGAATCATTACGGTGCCATATGGTGCCATATGAACTGCCTGCGGATGGATGTCTCCTATTTGTTCACCTTTTTTCCCATTGGTGAATATCCCGAGAGACAATGAGATTGCCACGTGCTTCGGCAACGGCGGCAATACGGTCTATGATATTACTATCGCTGGCTGAGGCTCAGAGCATCCGGCGACATCTGTGAAGA

Full Affymetrix probeset data:

Annotations for 1633050_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720