FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633051_at:

>probe:Drosophila_2:1633051_at:81:625; Interrogation_Position=1362; Antisense; TGCGAATTGCGAGTCGACGCAGGCA
>probe:Drosophila_2:1633051_at:442:247; Interrogation_Position=1366; Antisense; AATTGCGAGTCGACGCAGGCAAGAA
>probe:Drosophila_2:1633051_at:530:295; Interrogation_Position=1379; Antisense; CGCAGGCAAGAAGAAGACGATTTCG
>probe:Drosophila_2:1633051_at:66:377; Interrogation_Position=1391; Antisense; GAAGACGATTTCGACGATGCCCAGT
>probe:Drosophila_2:1633051_at:345:409; Interrogation_Position=1394; Antisense; GACGATTTCGACGATGCCCAGTGAA
>probe:Drosophila_2:1633051_at:414:459; Interrogation_Position=1397; Antisense; GATTTCGACGATGCCCAGTGAATGG
>probe:Drosophila_2:1633051_at:315:637; Interrogation_Position=1401; Antisense; TCGACGATGCCCAGTGAATGGCAGG
>probe:Drosophila_2:1633051_at:95:535; Interrogation_Position=1426; Antisense; GGTGAATAGTCGCTTTCTGCCTCTT
>probe:Drosophila_2:1633051_at:542:237; Interrogation_Position=1430; Antisense; AATAGTCGCTTTCTGCCTCTTTTTT
>probe:Drosophila_2:1633051_at:684:341; Interrogation_Position=1437; Antisense; GCTTTCTGCCTCTTTTTTTTATATA
>probe:Drosophila_2:1633051_at:191:23; Interrogation_Position=1461; Antisense; ATATAACACATATTTCGGCTGATAA
>probe:Drosophila_2:1633051_at:473:31; Interrogation_Position=1463; Antisense; ATAACACATATTTCGGCTGATAAGA
>probe:Drosophila_2:1633051_at:175:329; Interrogation_Position=1478; Antisense; GCTGATAAGAACAGGCTGGGCCTCT
>probe:Drosophila_2:1633051_at:506:29; Interrogation_Position=1482; Antisense; ATAAGAACAGGCTGGGCCTCTTATC

Paste this into a BLAST search page for me
TGCGAATTGCGAGTCGACGCAGGCAAATTGCGAGTCGACGCAGGCAAGAACGCAGGCAAGAAGAAGACGATTTCGGAAGACGATTTCGACGATGCCCAGTGACGATTTCGACGATGCCCAGTGAAGATTTCGACGATGCCCAGTGAATGGTCGACGATGCCCAGTGAATGGCAGGGGTGAATAGTCGCTTTCTGCCTCTTAATAGTCGCTTTCTGCCTCTTTTTTGCTTTCTGCCTCTTTTTTTTATATAATATAACACATATTTCGGCTGATAAATAACACATATTTCGGCTGATAAGAGCTGATAAGAACAGGCTGGGCCTCTATAAGAACAGGCTGGGCCTCTTATC

Full Affymetrix probeset data:

Annotations for 1633051_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720