FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633053_at:

>probe:Drosophila_2:1633053_at:325:333; Interrogation_Position=125; Antisense; GCTGGCTGTGGCCAATGCTGTTCCA
>probe:Drosophila_2:1633053_at:408:595; Interrogation_Position=131; Antisense; TGTGGCCAATGCTGTTCCACTGTCG
>probe:Drosophila_2:1633053_at:88:93; Interrogation_Position=17; Antisense; AGTTCAATCCAATCAATTGCCCAGT
>probe:Drosophila_2:1633053_at:526:33; Interrogation_Position=177; Antisense; ATCAATGGCGATTGCAGGGTGTGCA
>probe:Drosophila_2:1633053_at:725:5; Interrogation_Position=187; Antisense; ATTGCAGGGTGTGCAATGTCCACGG
>probe:Drosophila_2:1633053_at:639:309; Interrogation_Position=206; Antisense; CCACGGTGGCAAGTAGGAAGTTTCA
>probe:Drosophila_2:1633053_at:115:359; Interrogation_Position=214; Antisense; GCAAGTAGGAAGTTTCAACCCAAGG
>probe:Drosophila_2:1633053_at:195:543; Interrogation_Position=237; Antisense; GGATTCGAAAAAGGACATAGTCTAC
>probe:Drosophila_2:1633053_at:104:241; Interrogation_Position=27; Antisense; AATCAATTGCCCAGTGCACTCAGTA
>probe:Drosophila_2:1633053_at:678:119; Interrogation_Position=277; Antisense; AGCTGTTACCATTTTTTACTGGAAT
>probe:Drosophila_2:1633053_at:479:435; Interrogation_Position=347; Antisense; GAGGATTCTATTTCCTTTCTAACTA
>probe:Drosophila_2:1633053_at:615:83; Interrogation_Position=39; Antisense; AGTGCACTCAGTATCCAAAACCGGA
>probe:Drosophila_2:1633053_at:727:181; Interrogation_Position=55; Antisense; AAAACCGGAGAAATCCATCCAGAAT
>probe:Drosophila_2:1633053_at:563:423; Interrogation_Position=62; Antisense; GAGAAATCCATCCAGAATCAATATG

Paste this into a BLAST search page for me
GCTGGCTGTGGCCAATGCTGTTCCATGTGGCCAATGCTGTTCCACTGTCGAGTTCAATCCAATCAATTGCCCAGTATCAATGGCGATTGCAGGGTGTGCAATTGCAGGGTGTGCAATGTCCACGGCCACGGTGGCAAGTAGGAAGTTTCAGCAAGTAGGAAGTTTCAACCCAAGGGGATTCGAAAAAGGACATAGTCTACAATCAATTGCCCAGTGCACTCAGTAAGCTGTTACCATTTTTTACTGGAATGAGGATTCTATTTCCTTTCTAACTAAGTGCACTCAGTATCCAAAACCGGAAAAACCGGAGAAATCCATCCAGAATGAGAAATCCATCCAGAATCAATATG

Full Affymetrix probeset data:

Annotations for 1633053_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720