FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633054_at:

>probe:Drosophila_2:1633054_at:587:481; Interrogation_Position=129; Antisense; GTATTACGGAGTCTATGGCCTCGCC
>probe:Drosophila_2:1633054_at:721:631; Interrogation_Position=149; Antisense; TCGCCGTGATCGAGCAGGGATTTCG
>probe:Drosophila_2:1633054_at:9:229; Interrogation_Position=201; Antisense; AATGGCAATCATACGCTGTCTCCAT
>probe:Drosophila_2:1633054_at:710:515; Interrogation_Position=241; Antisense; GTGTCCAGCGTATTGCCATTGATTA
>probe:Drosophila_2:1633054_at:37:147; Interrogation_Position=265; Antisense; ACTTTGATCGGAGATGTACGGGCCA
>probe:Drosophila_2:1633054_at:352:487; Interrogation_Position=280; Antisense; GTACGGGCCAAGTTTAGGACGCTGT
>probe:Drosophila_2:1633054_at:336:75; Interrogation_Position=295; Antisense; AGGACGCTGTACATTGGTGCCACCA
>probe:Drosophila_2:1633054_at:377:173; Interrogation_Position=353; Antisense; AAAAACAGTTCCTGGACCGCACCAT
>probe:Drosophila_2:1633054_at:423:27; Interrogation_Position=37; Antisense; ATAGCGGTGCAGATTGTGCCCTACA
>probe:Drosophila_2:1633054_at:315:65; Interrogation_Position=376; Antisense; ATGGGTCAGATAACCTCCGCCAAGG
>probe:Drosophila_2:1633054_at:220:225; Interrogation_Position=397; Antisense; AAGGAGCGCCAGGATCTCTTCAAGC
>probe:Drosophila_2:1633054_at:609:645; Interrogation_Position=416; Antisense; TCAAGCGCGTAATGGAGTTCGACAT
>probe:Drosophila_2:1633054_at:379:255; Interrogation_Position=65; Antisense; CAACACAATCTCTGCGACTCAACGA
>probe:Drosophila_2:1633054_at:652:413; Interrogation_Position=99; Antisense; GACCAAGATCCTGCTTCAGAATGTG

Paste this into a BLAST search page for me
GTATTACGGAGTCTATGGCCTCGCCTCGCCGTGATCGAGCAGGGATTTCGAATGGCAATCATACGCTGTCTCCATGTGTCCAGCGTATTGCCATTGATTAACTTTGATCGGAGATGTACGGGCCAGTACGGGCCAAGTTTAGGACGCTGTAGGACGCTGTACATTGGTGCCACCAAAAAACAGTTCCTGGACCGCACCATATAGCGGTGCAGATTGTGCCCTACAATGGGTCAGATAACCTCCGCCAAGGAAGGAGCGCCAGGATCTCTTCAAGCTCAAGCGCGTAATGGAGTTCGACATCAACACAATCTCTGCGACTCAACGAGACCAAGATCCTGCTTCAGAATGTG

Full Affymetrix probeset data:

Annotations for 1633054_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720