Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633055_at:

>probe:Drosophila_2:1633055_at:314:607; Interrogation_Position=1005; Antisense; TGATGCAGCGCCTGGAACAGCTATC
>probe:Drosophila_2:1633055_at:258:561; Interrogation_Position=1018; Antisense; GGAACAGCTATCCATCTCCATCGAG
>probe:Drosophila_2:1633055_at:343:415; Interrogation_Position=1054; Antisense; GAGCCACACGGGTCTCTGAGATTTG
>probe:Drosophila_2:1633055_at:600:587; Interrogation_Position=1153; Antisense; TGGAGCTGGATTGGGATTTCACACA
>probe:Drosophila_2:1633055_at:584:529; Interrogation_Position=1165; Antisense; GGGATTTCACACAAGACTAGCGACT
>probe:Drosophila_2:1633055_at:249:123; Interrogation_Position=1183; Antisense; AGCGACTTTTCGACGGTGCGGACAG
>probe:Drosophila_2:1633055_at:656:461; Interrogation_Position=1253; Antisense; GATTCGATGGGCTTCTCATGCTAAA
>probe:Drosophila_2:1633055_at:205:325; Interrogation_Position=1285; Antisense; GCGAACTCGCAGTGATTGTGAAACT
>probe:Drosophila_2:1633055_at:589:699; Interrogation_Position=1312; Antisense; TTTAGATTGTCTTCGCGTAGCCATA
>probe:Drosophila_2:1633055_at:235:125; Interrogation_Position=1330; Antisense; AGCCATAGCCATAGCGTTAAATTAT
>probe:Drosophila_2:1633055_at:699:17; Interrogation_Position=1401; Antisense; ATTTCATTGCAATTCGATTCGACTC
>probe:Drosophila_2:1633055_at:184:507; Interrogation_Position=1442; Antisense; GTGCTGCAGGTTATCAGGCTTCGAT
>probe:Drosophila_2:1633055_at:24:367; Interrogation_Position=1475; Antisense; GAATCTGTTCCGCTTATTGTTTGTT
>probe:Drosophila_2:1633055_at:142:61; Interrogation_Position=1538; Antisense; CATGTACGAAACTCGGACCCATTAA

Paste this into a BLAST search page for me
TGATGCAGCGCCTGGAACAGCTATCGGAACAGCTATCCATCTCCATCGAGGAGCCACACGGGTCTCTGAGATTTGTGGAGCTGGATTGGGATTTCACACAGGGATTTCACACAAGACTAGCGACTAGCGACTTTTCGACGGTGCGGACAGGATTCGATGGGCTTCTCATGCTAAAGCGAACTCGCAGTGATTGTGAAACTTTTAGATTGTCTTCGCGTAGCCATAAGCCATAGCCATAGCGTTAAATTATATTTCATTGCAATTCGATTCGACTCGTGCTGCAGGTTATCAGGCTTCGATGAATCTGTTCCGCTTATTGTTTGTTCATGTACGAAACTCGGACCCATTAA

Full Affymetrix probeset data:

Annotations for 1633055_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime