FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633056_at:

>probe:Drosophila_2:1633056_at:438:441; Interrogation_Position=1027; Antisense; GATGTGATGGTATCGGTGCCTTCCG
>probe:Drosophila_2:1633056_at:659:389; Interrogation_Position=1090; Antisense; GAAACGAAGCAGCAGGTCACCTACC
>probe:Drosophila_2:1633056_at:664:685; Interrogation_Position=1138; Antisense; TATTTCCGACGCGTTGGCAATGACA
>probe:Drosophila_2:1633056_at:40:403; Interrogation_Position=1159; Antisense; GACATTCTAACCGACAAGCACCTAA
>probe:Drosophila_2:1633056_at:695:175; Interrogation_Position=1182; Antisense; AAACATCTCGGAGGCCATTCTGGGC
>probe:Drosophila_2:1633056_at:49:275; Interrogation_Position=1197; Antisense; CATTCTGGGCGGATCCTTTCAGATA
>probe:Drosophila_2:1633056_at:270:203; Interrogation_Position=1327; Antisense; AACCACATCGTCACGCTGAAGGTGC
>probe:Drosophila_2:1633056_at:646:611; Interrogation_Position=1343; Antisense; TGAAGGTGCGTATACCCCGGAATCT
>probe:Drosophila_2:1633056_at:232:367; Interrogation_Position=1362; Antisense; GAATCTCTCCGTAAAGCAACGCCAA
>probe:Drosophila_2:1633056_at:519:701; Interrogation_Position=1391; Antisense; TTTTGGCACTGTCCCAGGCAGAGGA
>probe:Drosophila_2:1633056_at:4:99; Interrogation_Position=1410; Antisense; AGAGGATCCGGTTTTCGAGCCCAAG
>probe:Drosophila_2:1633056_at:186:549; Interrogation_Position=1446; Antisense; GGAGGCGGGCAATTTGAGTCACTAA
>probe:Drosophila_2:1633056_at:470:225; Interrogation_Position=1478; Antisense; AATGTACCGGCCTCATTGCGTTTAC
>probe:Drosophila_2:1633056_at:404:179; Interrogation_Position=989; Antisense; AAACATGTTCGAATCGCGGCTTCGT

Paste this into a BLAST search page for me
GATGTGATGGTATCGGTGCCTTCCGGAAACGAAGCAGCAGGTCACCTACCTATTTCCGACGCGTTGGCAATGACAGACATTCTAACCGACAAGCACCTAAAAACATCTCGGAGGCCATTCTGGGCCATTCTGGGCGGATCCTTTCAGATAAACCACATCGTCACGCTGAAGGTGCTGAAGGTGCGTATACCCCGGAATCTGAATCTCTCCGTAAAGCAACGCCAATTTTGGCACTGTCCCAGGCAGAGGAAGAGGATCCGGTTTTCGAGCCCAAGGGAGGCGGGCAATTTGAGTCACTAAAATGTACCGGCCTCATTGCGTTTACAAACATGTTCGAATCGCGGCTTCGT

Full Affymetrix probeset data:

Annotations for 1633056_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720