Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633057_at:

>probe:Drosophila_2:1633057_at:368:547; Interrogation_Position=1175; Antisense; GGAGGAACTTCAGATTGGATGTGAT
>probe:Drosophila_2:1633057_at:578:363; Interrogation_Position=1200; Antisense; GAATCAAATTCAGTGTGCTCAAGAG
>probe:Drosophila_2:1633057_at:278:265; Interrogation_Position=1210; Antisense; CAGTGTGCTCAAGAGGAAACCCAGA
>probe:Drosophila_2:1633057_at:392:309; Interrogation_Position=1230; Antisense; CCAGAAAACTCTGACGCAACTCGTT
>probe:Drosophila_2:1633057_at:357:609; Interrogation_Position=1241; Antisense; TGACGCAACTCGTTATTATTATGTT
>probe:Drosophila_2:1633057_at:420:15; Interrogation_Position=1258; Antisense; ATTATGTTAATTCTGGACCACACTC
>probe:Drosophila_2:1633057_at:273:555; Interrogation_Position=1272; Antisense; GGACCACACTCAAAGATGTTTTCGA
>probe:Drosophila_2:1633057_at:458:443; Interrogation_Position=1286; Antisense; GATGTTTTCGAAGTAGCCAGCTGGA
>probe:Drosophila_2:1633057_at:239:487; Interrogation_Position=1298; Antisense; GTAGCCAGCTGGAATGTTATGCCTG
>probe:Drosophila_2:1633057_at:211:705; Interrogation_Position=1314; Antisense; TTATGCCTGGAGTGCATCTCGGCCA
>probe:Drosophila_2:1633057_at:648:507; Interrogation_Position=1325; Antisense; GTGCATCTCGGCCAGCATGACAAGG
>probe:Drosophila_2:1633057_at:394:397; Interrogation_Position=1343; Antisense; GACAAGGCTGCCGACATTTTGAGAT
>probe:Drosophila_2:1633057_at:490:401; Interrogation_Position=1355; Antisense; GACATTTTGAGATAGCACCCGCCGT
>probe:Drosophila_2:1633057_at:631:469; Interrogation_Position=1378; Antisense; GTTCCAGCTGCTTGCATTTACAATA

Paste this into a BLAST search page for me
GGAGGAACTTCAGATTGGATGTGATGAATCAAATTCAGTGTGCTCAAGAGCAGTGTGCTCAAGAGGAAACCCAGACCAGAAAACTCTGACGCAACTCGTTTGACGCAACTCGTTATTATTATGTTATTATGTTAATTCTGGACCACACTCGGACCACACTCAAAGATGTTTTCGAGATGTTTTCGAAGTAGCCAGCTGGAGTAGCCAGCTGGAATGTTATGCCTGTTATGCCTGGAGTGCATCTCGGCCAGTGCATCTCGGCCAGCATGACAAGGGACAAGGCTGCCGACATTTTGAGATGACATTTTGAGATAGCACCCGCCGTGTTCCAGCTGCTTGCATTTACAATA

Full Affymetrix probeset data:

Annotations for 1633057_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime