FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633058_at:

>probe:Drosophila_2:1633058_at:659:21; Interrogation_Position=133; Antisense; ATAATGGCCGAGCTACTTTTTCCAC
>probe:Drosophila_2:1633058_at:636:447; Interrogation_Position=235; Antisense; GATGCCCCGTTCATGAAGATGTCCA
>probe:Drosophila_2:1633058_at:660:271; Interrogation_Position=261; Antisense; CATCAAGCTGCATCTCACGGACAAC
>probe:Drosophila_2:1633058_at:191:203; Interrogation_Position=283; Antisense; AACCTCATCCTGCAGACGATCAAGA
>probe:Drosophila_2:1633058_at:155:385; Interrogation_Position=306; Antisense; GAACATCCGGCAGTATGACACCATC
>probe:Drosophila_2:1633058_at:632:453; Interrogation_Position=354; Antisense; GATAAACTTCAAGCGGCGGCTGACC
>probe:Drosophila_2:1633058_at:350:551; Interrogation_Position=405; Antisense; GGAGAAGCTCGGCTTGCACATCGAT
>probe:Drosophila_2:1633058_at:702:633; Interrogation_Position=425; Antisense; TCGATCCCCGGAAACTCAACGAGGA
>probe:Drosophila_2:1633058_at:374:567; Interrogation_Position=451; Antisense; GGCAAATGGCACTGAAGTCCGATTA
>probe:Drosophila_2:1633058_at:7:563; Interrogation_Position=479; Antisense; GGAACTCCAGAATCTAATCGCCCAT
>probe:Drosophila_2:1633058_at:142:45; Interrogation_Position=495; Antisense; ATCGCCCATCTAAACGCTATCGTAT
>probe:Drosophila_2:1633058_at:255:491; Interrogation_Position=576; Antisense; GTAAGCAATGTCTCCTCAAGTTTCT
>probe:Drosophila_2:1633058_at:428:173; Interrogation_Position=73; Antisense; AAAGCGAACAGATCTCTGCGCAGCA
>probe:Drosophila_2:1633058_at:711:623; Interrogation_Position=89; Antisense; TGCGCAGCACTCATATTCCCAGTAA

Paste this into a BLAST search page for me
ATAATGGCCGAGCTACTTTTTCCACGATGCCCCGTTCATGAAGATGTCCACATCAAGCTGCATCTCACGGACAACAACCTCATCCTGCAGACGATCAAGAGAACATCCGGCAGTATGACACCATCGATAAACTTCAAGCGGCGGCTGACCGGAGAAGCTCGGCTTGCACATCGATTCGATCCCCGGAAACTCAACGAGGAGGCAAATGGCACTGAAGTCCGATTAGGAACTCCAGAATCTAATCGCCCATATCGCCCATCTAAACGCTATCGTATGTAAGCAATGTCTCCTCAAGTTTCTAAAGCGAACAGATCTCTGCGCAGCATGCGCAGCACTCATATTCCCAGTAA

Full Affymetrix probeset data:

Annotations for 1633058_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720