Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633059_at:

>probe:Drosophila_2:1633059_at:328:443; Interrogation_Position=1029; Antisense; GATGATAATACATGTCAGGCAGCAT
>probe:Drosophila_2:1633059_at:550:199; Interrogation_Position=1111; Antisense; AACGCCGAACTATATTTTGCGACAA
>probe:Drosophila_2:1633059_at:394:685; Interrogation_Position=1126; Antisense; TTTGCGACAATTGGAAAGCGATTCA
>probe:Drosophila_2:1633059_at:675:327; Interrogation_Position=1143; Antisense; GCGATTCAGGAACACAATGAGCAGT
>probe:Drosophila_2:1633059_at:533:39; Interrogation_Position=1166; Antisense; GTTCGAATTGGGAGTGGAATCTTTC
>probe:Drosophila_2:1633059_at:590:185; Interrogation_Position=1243; Antisense; AACAACGACCTAATTTAGCTCCAGA
>probe:Drosophila_2:1633059_at:205:705; Interrogation_Position=1257; Antisense; TTAGCTCCAGAGTTTTCAAAAGAAG
>probe:Drosophila_2:1633059_at:291:265; Interrogation_Position=1371; Antisense; CAGATGAAATGTTTGTCACCTTTTA
>probe:Drosophila_2:1633059_at:388:477; Interrogation_Position=1381; Antisense; GTTTGTCACCTTTTAAATACACGCA
>probe:Drosophila_2:1633059_at:568:295; Interrogation_Position=831; Antisense; CGAAATGTATTTTGCGACAACTTTA
>probe:Drosophila_2:1633059_at:258:357; Interrogation_Position=869; Antisense; GCACAATGTTCAATTCGATTTGGGA
>probe:Drosophila_2:1633059_at:162:35; Interrogation_Position=919; Antisense; ATCAGTGGAGTGATTTGACCGTTGA
>probe:Drosophila_2:1633059_at:416:487; Interrogation_Position=948; Antisense; TGGAAAAACAAACAACGACCTGCTT
>probe:Drosophila_2:1633059_at:116:199; Interrogation_Position=961; Antisense; AACGACCTGCTTTTAATCCAGAGTT

Paste this into a BLAST search page for me
GATGATAATACATGTCAGGCAGCATAACGCCGAACTATATTTTGCGACAATTTGCGACAATTGGAAAGCGATTCAGCGATTCAGGAACACAATGAGCAGTGTTCGAATTGGGAGTGGAATCTTTCAACAACGACCTAATTTAGCTCCAGATTAGCTCCAGAGTTTTCAAAAGAAGCAGATGAAATGTTTGTCACCTTTTAGTTTGTCACCTTTTAAATACACGCACGAAATGTATTTTGCGACAACTTTAGCACAATGTTCAATTCGATTTGGGAATCAGTGGAGTGATTTGACCGTTGATGGAAAAACAAACAACGACCTGCTTAACGACCTGCTTTTAATCCAGAGTT

Full Affymetrix probeset data:

Annotations for 1633059_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime