FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633060_at:

>probe:Drosophila_2:1633060_at:15:29; Interrogation_Position=1016; Antisense; ATACGGACGTACAGCAGCGCCTGCG
>probe:Drosophila_2:1633060_at:336:313; Interrogation_Position=1152; Antisense; GCCACTGCCGTTTTTGGATCGCGAG
>probe:Drosophila_2:1633060_at:655:729; Interrogation_Position=1165; Antisense; TTGGATCGCGAGTGCACTTCTGGGA
>probe:Drosophila_2:1633060_at:557:715; Interrogation_Position=1182; Antisense; TTCTGGGAGGGATTACTCGCTGGCT
>probe:Drosophila_2:1633060_at:366:339; Interrogation_Position=1202; Antisense; TGGCTCCGTTCCACAAAAAGTTCGT
>probe:Drosophila_2:1633060_at:291:49; Interrogation_Position=1240; Antisense; ATGCCCGTTTATATACCCTGCTATG
>probe:Drosophila_2:1633060_at:5:257; Interrogation_Position=1282; Antisense; CAGTACTTTCCTCAACCGCGAAAAT
>probe:Drosophila_2:1633060_at:192:627; Interrogation_Position=1310; Antisense; TGCCTGAAAGATTCTCGCCCGAGAA
>probe:Drosophila_2:1633060_at:286:349; Interrogation_Position=1383; Antisense; GCATGGCTGCATCGGAGAACGTTTT
>probe:Drosophila_2:1633060_at:258:381; Interrogation_Position=1399; Antisense; GAACGTTTTGGATATCTCCAGGCGA
>probe:Drosophila_2:1633060_at:261:593; Interrogation_Position=1427; Antisense; TGGGTCTGGTTAACCTGCTGCGCAA
>probe:Drosophila_2:1633060_at:610:253; Interrogation_Position=1449; Antisense; CAACCACATGATAACCACCTCGGAG
>probe:Drosophila_2:1633060_at:698:119; Interrogation_Position=1493; Antisense; AGCTGGATCCCAAGGCCATCATAAC
>probe:Drosophila_2:1633060_at:95:131; Interrogation_Position=1538; Antisense; ACCTACGGCTGGTTCGCGATGCTTT

Paste this into a BLAST search page for me
ATACGGACGTACAGCAGCGCCTGCGGCCACTGCCGTTTTTGGATCGCGAGTTGGATCGCGAGTGCACTTCTGGGATTCTGGGAGGGATTACTCGCTGGCTTGGCTCCGTTCCACAAAAAGTTCGTATGCCCGTTTATATACCCTGCTATGCAGTACTTTCCTCAACCGCGAAAATTGCCTGAAAGATTCTCGCCCGAGAAGCATGGCTGCATCGGAGAACGTTTTGAACGTTTTGGATATCTCCAGGCGATGGGTCTGGTTAACCTGCTGCGCAACAACCACATGATAACCACCTCGGAGAGCTGGATCCCAAGGCCATCATAACACCTACGGCTGGTTCGCGATGCTTT

Full Affymetrix probeset data:

Annotations for 1633060_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720