FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633061_at:

>probe:Drosophila_2:1633061_at:658:199; Interrogation_Position=2852; Antisense; AACCCTCTAGTCACACATTCAATTG
>probe:Drosophila_2:1633061_at:137:3; Interrogation_Position=2873; Antisense; ATTGGAATCGCCGTGTTGTTGCAAC
>probe:Drosophila_2:1633061_at:483:467; Interrogation_Position=2887; Antisense; GTTGTTGCAACCTCCAATCTTGTGC
>probe:Drosophila_2:1633061_at:493:471; Interrogation_Position=2913; Antisense; GTTCGCCCTTCAGTTTGTCGATCAT
>probe:Drosophila_2:1633061_at:154:371; Interrogation_Position=2943; Antisense; GAAGTGTTTAGGCTCCGTCCAGATC
>probe:Drosophila_2:1633061_at:730:447; Interrogation_Position=2964; Antisense; GATCCAAAGATCGACAGAGTTCCAA
>probe:Drosophila_2:1633061_at:615:523; Interrogation_Position=2995; Antisense; GGGCGGCAATCCTTCAAACTGAAAC
>probe:Drosophila_2:1633061_at:6:25; Interrogation_Position=3068; Antisense; ATATGTACTAACTCGTATCCCCAGA
>probe:Drosophila_2:1633061_at:506:95; Interrogation_Position=3090; Antisense; AGATTGTGCCGAAGCCGTTTCGCAA
>probe:Drosophila_2:1633061_at:682:357; Interrogation_Position=3111; Antisense; GCAAGCGGCCAATTAATTTGAGTCT
>probe:Drosophila_2:1633061_at:182:703; Interrogation_Position=3217; Antisense; TTTTGATATATCTACGAGCCTACGT
>probe:Drosophila_2:1633061_at:482:415; Interrogation_Position=3232; Antisense; GAGCCTACGTTTTAAGCCTGTACAT
>probe:Drosophila_2:1633061_at:274:237; Interrogation_Position=3334; Antisense; AATCGTTAGTCCAAAGCGCTTTTAT
>probe:Drosophila_2:1633061_at:6:201; Interrogation_Position=3403; Antisense; AACGCCAAGTAAATGCTCTACCAGT

Paste this into a BLAST search page for me
AACCCTCTAGTCACACATTCAATTGATTGGAATCGCCGTGTTGTTGCAACGTTGTTGCAACCTCCAATCTTGTGCGTTCGCCCTTCAGTTTGTCGATCATGAAGTGTTTAGGCTCCGTCCAGATCGATCCAAAGATCGACAGAGTTCCAAGGGCGGCAATCCTTCAAACTGAAACATATGTACTAACTCGTATCCCCAGAAGATTGTGCCGAAGCCGTTTCGCAAGCAAGCGGCCAATTAATTTGAGTCTTTTTGATATATCTACGAGCCTACGTGAGCCTACGTTTTAAGCCTGTACATAATCGTTAGTCCAAAGCGCTTTTATAACGCCAAGTAAATGCTCTACCAGT

Full Affymetrix probeset data:

Annotations for 1633061_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720