FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633064_at:

>probe:Drosophila_2:1633064_at:243:615; Interrogation_Position=1000; Antisense; TGCAATGCTCTCCTGGATCTCTACA
>probe:Drosophila_2:1633064_at:228:629; Interrogation_Position=1067; Antisense; TCCTGAACGGACTGGATCGCTATCA
>probe:Drosophila_2:1633064_at:721:449; Interrogation_Position=1081; Antisense; GATCGCTATCAAGGGAATTCACTGT
>probe:Drosophila_2:1633064_at:412:159; Interrogation_Position=545; Antisense; ACAACTACGCTAGGGAGATCCGGGA
>probe:Drosophila_2:1633064_at:213:419; Interrogation_Position=594; Antisense; GAGCTGCTCGCTGCAGAACAGTGAG
>probe:Drosophila_2:1633064_at:360:609; Interrogation_Position=615; Antisense; TGAGACGAACGTGGAGGCCTCCTGT
>probe:Drosophila_2:1633064_at:578:629; Interrogation_Position=634; Antisense; TCCTGTGCCGTGGTCAAAGCAGCGG
>probe:Drosophila_2:1633064_at:703:329; Interrogation_Position=655; Antisense; GCGGAGGTTCAAGCCGAAACATTCA
>probe:Drosophila_2:1633064_at:730:149; Interrogation_Position=673; Antisense; ACATTCAGGGCCCTCGTACAGCAGA
>probe:Drosophila_2:1633064_at:64:105; Interrogation_Position=695; Antisense; AGACGAGTGGCATTTTGTCGGAAAT
>probe:Drosophila_2:1633064_at:329:583; Interrogation_Position=719; Antisense; TGGACAGCCTAATCGACCAGTCGAA
>probe:Drosophila_2:1633064_at:532:181; Interrogation_Position=893; Antisense; AAAAGGTCGGCACCGGCAGTTTGCT
>probe:Drosophila_2:1633064_at:44:695; Interrogation_Position=912; Antisense; TTTGCTGTACAAGTCGTCGGTTCAC
>probe:Drosophila_2:1633064_at:685:329; Interrogation_Position=974; Antisense; GCGGTTACGCACTCGACAGGAACAC

Paste this into a BLAST search page for me
TGCAATGCTCTCCTGGATCTCTACATCCTGAACGGACTGGATCGCTATCAGATCGCTATCAAGGGAATTCACTGTACAACTACGCTAGGGAGATCCGGGAGAGCTGCTCGCTGCAGAACAGTGAGTGAGACGAACGTGGAGGCCTCCTGTTCCTGTGCCGTGGTCAAAGCAGCGGGCGGAGGTTCAAGCCGAAACATTCAACATTCAGGGCCCTCGTACAGCAGAAGACGAGTGGCATTTTGTCGGAAATTGGACAGCCTAATCGACCAGTCGAAAAAAGGTCGGCACCGGCAGTTTGCTTTTGCTGTACAAGTCGTCGGTTCACGCGGTTACGCACTCGACAGGAACAC

Full Affymetrix probeset data:

Annotations for 1633064_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720