FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633066_at:

>probe:Drosophila_2:1633066_at:560:475; Interrogation_Position=112; Antisense; GTTTCGGCCACGGATATTACCGGAG
>probe:Drosophila_2:1633066_at:63:707; Interrogation_Position=128; Antisense; TTACCGGAGAGCCAGTGCGCCAGAA
>probe:Drosophila_2:1633066_at:536:371; Interrogation_Position=15; Antisense; GAAGTGCATCATATCCATCGTTGTG
>probe:Drosophila_2:1633066_at:564:201; Interrogation_Position=151; Antisense; AAGCGATCCAGTGCGGATTACTACC
>probe:Drosophila_2:1633066_at:146:665; Interrogation_Position=169; Antisense; TACTACCAGGGCGACTATTTCATCT
>probe:Drosophila_2:1633066_at:349:147; Interrogation_Position=182; Antisense; ACTATTTCATCTGCTATCCCAAGAG
>probe:Drosophila_2:1633066_at:501:45; Interrogation_Position=197; Antisense; ATCCCAAGAGCGCAGTGTACGGCAA
>probe:Drosophila_2:1633066_at:57:545; Interrogation_Position=226; Antisense; GGATACGGTGCAACCAATCGCAGAT
>probe:Drosophila_2:1633066_at:41:237; Interrogation_Position=241; Antisense; AATCGCAGATCCTACGACTCGGAAG
>probe:Drosophila_2:1633066_at:531:47; Interrogation_Position=27; Antisense; ATCCATCGTTGTGATCTCCATGATC
>probe:Drosophila_2:1633066_at:641:147; Interrogation_Position=278; Antisense; ACTATTTGGCCGACGATCCATTGGT
>probe:Drosophila_2:1633066_at:45:307; Interrogation_Position=338; Antisense; CCTACACCGACAGCTTTGGCAAATA
>probe:Drosophila_2:1633066_at:632:307; Interrogation_Position=44; Antisense; CCATGATCTTCGGTTTAAGCCTGAT
>probe:Drosophila_2:1633066_at:687:109; Interrogation_Position=98; Antisense; AGAATCCAGGATTCGTTTCGGCCAC

Paste this into a BLAST search page for me
GTTTCGGCCACGGATATTACCGGAGTTACCGGAGAGCCAGTGCGCCAGAAGAAGTGCATCATATCCATCGTTGTGAAGCGATCCAGTGCGGATTACTACCTACTACCAGGGCGACTATTTCATCTACTATTTCATCTGCTATCCCAAGAGATCCCAAGAGCGCAGTGTACGGCAAGGATACGGTGCAACCAATCGCAGATAATCGCAGATCCTACGACTCGGAAGATCCATCGTTGTGATCTCCATGATCACTATTTGGCCGACGATCCATTGGTCCTACACCGACAGCTTTGGCAAATACCATGATCTTCGGTTTAAGCCTGATAGAATCCAGGATTCGTTTCGGCCAC

Full Affymetrix probeset data:

Annotations for 1633066_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720