Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633067_at:

>probe:Drosophila_2:1633067_at:6:141; Interrogation_Position=146; Antisense; ACGGGCACACCTTCGGCATTCAGTA
>probe:Drosophila_2:1633067_at:574:569; Interrogation_Position=160; Antisense; GGCATTCAGTACGTGCGCAAGGACA
>probe:Drosophila_2:1633067_at:83:93; Interrogation_Position=215; Antisense; AGTTCAACTGCAAGGCGCGCGTGAC
>probe:Drosophila_2:1633067_at:74:391; Interrogation_Position=247; Antisense; GACACCGGCGACATAATCGTGACCA
>probe:Drosophila_2:1633067_at:16:313; Interrogation_Position=284; Antisense; GCCACACAGAGATACGTCAGCACCT
>probe:Drosophila_2:1633067_at:53:649; Interrogation_Position=300; Antisense; TCAGCACCTGCGCAAGGATTACCAG
>probe:Drosophila_2:1633067_at:391:367; Interrogation_Position=342; Antisense; GAATGCACTGATTAACCTAAGTACG
>probe:Drosophila_2:1633067_at:482:89; Interrogation_Position=361; Antisense; AGTACGAGTCACATGCGGCGAAACA
>probe:Drosophila_2:1633067_at:590:81; Interrogation_Position=434; Antisense; AGGGTACACCCATTCACGAGATGGT
>probe:Drosophila_2:1633067_at:142:589; Interrogation_Position=545; Antisense; TGGAGGAGCCACTAGACTGCGGACT
>probe:Drosophila_2:1633067_at:671:99; Interrogation_Position=593; Antisense; AGATGGCACGCAGCTTCATGACCAA
>probe:Drosophila_2:1633067_at:11:647; Interrogation_Position=608; Antisense; TCATGACCAACAACAAACCCTCAAT
>probe:Drosophila_2:1633067_at:237:695; Interrogation_Position=637; Antisense; TTTCCGGGCAGCGAATCTGGTCATA
>probe:Drosophila_2:1633067_at:685:535; Interrogation_Position=655; Antisense; GGTCATAACCAGCATGGTAGCGATA

Paste this into a BLAST search page for me
ACGGGCACACCTTCGGCATTCAGTAGGCATTCAGTACGTGCGCAAGGACAAGTTCAACTGCAAGGCGCGCGTGACGACACCGGCGACATAATCGTGACCAGCCACACAGAGATACGTCAGCACCTTCAGCACCTGCGCAAGGATTACCAGGAATGCACTGATTAACCTAAGTACGAGTACGAGTCACATGCGGCGAAACAAGGGTACACCCATTCACGAGATGGTTGGAGGAGCCACTAGACTGCGGACTAGATGGCACGCAGCTTCATGACCAATCATGACCAACAACAAACCCTCAATTTTCCGGGCAGCGAATCTGGTCATAGGTCATAACCAGCATGGTAGCGATA

Full Affymetrix probeset data:

Annotations for 1633067_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime