FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633068_at:

>probe:Drosophila_2:1633068_at:178:683; Interrogation_Position=1590; Antisense; TATGATCTGTGCAACACCGGTCGAG
>probe:Drosophila_2:1633068_at:84:541; Interrogation_Position=1658; Antisense; GGTTCCGTGCGCTGAATGGGCCCAT
>probe:Drosophila_2:1633068_at:429:229; Interrogation_Position=1672; Antisense; AATGGGCCCATCTGGACATCCGTGG
>probe:Drosophila_2:1633068_at:67:71; Interrogation_Position=1725; Antisense; AGGCCCTACCTACTCAAGGACTCGA
>probe:Drosophila_2:1633068_at:172:225; Interrogation_Position=1740; Antisense; AAGGACTCGATGACCGGACGCCCGA
>probe:Drosophila_2:1633068_at:118:411; Interrogation_Position=1763; Antisense; GACGCGCACTGTTATCCAGTTCATG
>probe:Drosophila_2:1633068_at:313:265; Interrogation_Position=1791; Antisense; CAGATGGCCTGCTCCGGCTAGTAGA
>probe:Drosophila_2:1633068_at:186:569; Interrogation_Position=1806; Antisense; GGCTAGTAGAGTCCATGCCATGTAG
>probe:Drosophila_2:1633068_at:313:61; Interrogation_Position=1825; Antisense; ATGTAGACACACCTTCCTTGTGGGC
>probe:Drosophila_2:1633068_at:512:59; Interrogation_Position=1854; Antisense; ATGTTGGCCCATGTATTCGATATTT
>probe:Drosophila_2:1633068_at:130:447; Interrogation_Position=1879; Antisense; GATGCTTTGGTACAGTGTTTGCACA
>probe:Drosophila_2:1633068_at:385:11; Interrogation_Position=1912; Antisense; ATTCTGGTCTGGAGAAGCCATCCTC
>probe:Drosophila_2:1633068_at:396:379; Interrogation_Position=1925; Antisense; GAAGCCATCCTCGTAAAGGTTCACT
>probe:Drosophila_2:1633068_at:317:541; Interrogation_Position=1942; Antisense; GGTTCACTTTAATATCGTTGGCAAT

Paste this into a BLAST search page for me
TATGATCTGTGCAACACCGGTCGAGGGTTCCGTGCGCTGAATGGGCCCATAATGGGCCCATCTGGACATCCGTGGAGGCCCTACCTACTCAAGGACTCGAAAGGACTCGATGACCGGACGCCCGAGACGCGCACTGTTATCCAGTTCATGCAGATGGCCTGCTCCGGCTAGTAGAGGCTAGTAGAGTCCATGCCATGTAGATGTAGACACACCTTCCTTGTGGGCATGTTGGCCCATGTATTCGATATTTGATGCTTTGGTACAGTGTTTGCACAATTCTGGTCTGGAGAAGCCATCCTCGAAGCCATCCTCGTAAAGGTTCACTGGTTCACTTTAATATCGTTGGCAAT

Full Affymetrix probeset data:

Annotations for 1633068_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720